Sequences from confirmation amplicon


Confirmation sequences for line 641G04 and hit At3g57910 are shown.
Line ID 641G04
Locus At3g57910 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:21443086
Primers used for PCR NE78 - 8474, show primer details
   
Sequence Name 02-K102498-0022-641-G04C-8409
GenBank Accession LN486979 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>02-K102498-0022-641-G04C-8409
CGTAGAACATCACGGAAGAAGTTAAAAATCTCAATTGGCACGAGAGACGAAGATTGGAGA
AAGAGAGGAAACAGATAGAAGAAGATGAGCAGACATTGGCTCGTATAGTAGACACTCCAA
TAGGAGAGTCTAACATAGGGTTTAAGCTATTGAAGCAAATGGGTTACAAGCCAGGTTCTG
CTCTTGGTAAACAAGGCTCTGGTAGAGCTGAGCCAGTGACTATGGATATTCGAAGATCGA
GAGCCGGTGTGGGAAGAGAGGATCCACATAAGGAGAAGAAGAAAAAGGAGGAGATTGAGG
CTGAGAATGAGAAGAGAAAAGTGGATGAGATGTTGGAGGATTTTGGGTCTAGACAGAAGT
CTCAATGGCGTAAGAAAAGAGTTTTGATTAACTTTAGGAAGGCTAAGGCTGCTCTTGATC
AACTTGAGAATGTAGAAGTTGTTCCGGAGAAGAAAAATGAGGAAGATGAAGATGGAAAGG
CCTGA
   
Sequence Name 02-K102499-0022-641-G04C-NE78
GenBank Accession LN486980 [GenBank]
Sequencing primer gene specific primer, NE78: 5'-ATCAGGCTTACCATCTTCATCTTC-3'
Sequence (A. th genome BLAST matches underlined)
>02-K102499-0022-641-G04C-NE78
CTTCTAATTCTAAGTTGATCAAGAGCAGCCTTAGCCTTCCTAAAGTTAATCAAAACTCTT
TTCTTACGCCATTGAGACTTCTGTCTAGACCCAAAATCCTCCAACATCTCATCCACTTTT
CTCTTCTCATTCTCAGCCTCAATCTCCTCCTTTTTCTTCTTCTCCTTATGTGGATCCTCT
CTTCCCACACCGGCTCTCGATCTTCGAATATCCATAGTCACTGGCTCAGCTCTACCAGAG
CCTTGTTTACCAAGAGCAGAACCTGGCTTGTAACCCATTTGCTTCAATAGCTTAAACCCT
ATGTTAGACTCTCCTATTGGAGTGTCTACTATACGAGCCAATGTCTGCTCATCTTCTTCT
ATCTGTTTCCTCTCTTTCTCCAATCTTCGTCTCTCGTGCCAATTGAGATTTTTTAACTTC
TTCCGTGATGGTTCTACGATAACATGGATCATGTCCGGGAAATCTACATGGATCAGCAAT
GAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAA
AAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAAT
TACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTT
TATTTCGACGTGTCTACATTCACTCC

Last Updated on 07.07.2016 14:16