Sequences from confirmation amplicon


Confirmation sequences for line 642B07 and hit At5g39410 are shown.
Line ID 642B07
Locus At5g39410 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:15770305
Primers used for PCR NS25 - 8474, show primer details
   
Sequence Name 55-K102433-0022-642-B07C-8409
GenBank Accession LN508770 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>55-K102433-0022-642-B07C-8409
GCCATTTACTCATTGCTCCAAAAGATTCTCCGTCTTAGATTCCGATCACGATGAACCCAA
CCCAAAAACCCGAACCGGTTTACGATATGGTCATACTCGGAGCATCCGGATTTACCGGTA
AGTACGTCGTCAGAGAAGCTCTCAAGTTCCTTCAAACACCGTCTTCTTCTCCGTTAAAGT
CTCTAGCTTTAGCGGGTCGTAACCCGACCCGTTTAACCCAATCTCTCGAATGGGCCGCCC
GCCCGAACCCACCACCTTCCTCTGTCGCTATCCTCACTGCTGATACATCTGACCCTGATT
CACTTCGTCGTCTCTGTACTCAAACCAAACTCATCCTCAATTGTGTTGGACCGTTTCGTA
TCCATGGTGATCCTGTCGTCTCTGCTTGTGCTGATTCAGGGTAAAGTGTGAATCTTTTC
   
Sequence Name 55-K102434-0022-642-B07C-NS25
GenBank Accession LN508771 [GenBank]
Sequencing primer gene specific primer, NS25: 5'-GGAAAAGATTCACACTTTACCCTG-3'
Sequence (A. th genome BLAST matches underlined)
>55-K102434-0022-642-B07C-NS25
GGATCGAAACGGTCCACACAATTGAGGATGAGTTTGGTTTGAGTACAGAGACGACGAAGT
GAATCAGGGTCAGATGTATCAGCAGTGAGGATAGCGACAGAGGAAGGTGGTGGGTTCGGG
CGGGCGGCCCATTCGAGAGATTGGGTTAAACGGGTCGGGTTACGACCCGCTAAAGCTAGA
GACTTTAACGGAGAAGAAGACGGTGTTTGAAGGAACTTGAGAGCTTCTCTGACGACGTAC
TTACCGGTAAATCCGGATGCTCCGAGTATGACCATATCGTAAACCGGTTCGGGTTTTTGG
GTTGGGTTCATCGTGATCGGAATCTAAGACGGAGAATCTTTTTGGAGCAATGAGTAAATG
GCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAA
AAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATT
ATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGA
AAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGT
CCAAAATGG

Last Updated on 07.07.2016 14:16