Sequences from confirmation amplicon


Confirmation sequences for line 652G06 and hit At5g61640 are shown.
Line ID 652G06
Locus At5g61640 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24774940
Primers used for PCR NS17 - 8474, show primer details
   
Sequence Name 85-K102372-0022-652-G06C-8409
GenBank Accession LN514528 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>85-K102372-0022-652-G06C-8409
TTGATCATGTCAAAACTGGTTTCTAAAATTATTTTTATCGTTATTCAAAACGTAAACGCA
AACGCGAATTTTATACCTGTCAGAATTTGGTACAAAATGTTCCGCAGAATCAGCCGACGT
TTCCTCTTCACCACTTTCCTCTGTTTCTCTGTTTCGCTCTCTCTACAAAATTTCTCCATG
AACATACTTAACAAGCTAGGTATAGGATCAAGTAGACAAACCAACATGGATCCTTCTCCA
ATCGCACAAGTAATCGACGACGAAGCTCCGGCGCCGGGAAACCAGTTTACTCAATTCGGC
GCCGGTTGTTTCTGGAGCGTGGAATTAGCGTACCAGAGAGTTCCAGGAGTGACTCAAACA
GAGGTTGGTTATTCTCAAGGGATCACTCACGATCCTTCTTACAAAGATGTTTGTTCAGGT
ACCACGAATCATGCCGAGATTGTTCGTGTTCAATATGATCCAAAAGAGTGTAGTTACCAG
TCGCTGCTTGATTTGTTCTGGCTTAAGCAT
   
Sequence Name 85-K102373-0022-652-G06C-NS17
GenBank Accession LN514529 [GenBank]
Sequencing primer gene specific primer, NS17: 5'-CATGCTTAGACCAGAACAAATCAA-3'
Sequence (A. th genome BLAST matches underlined)
>85-K102373-0022-652-G06C-NS17
TCTTTTGGACAATTGAACCGAACAATCTCGGCATGATTCGTGGTACCTGAACAAACATCT
TTGTAAGAAGGATCGTGAGTGATCCCTTGAGAATAACCAACCTCTGTTTGAGTCACTCCT
GGAACTCTCTGGTACGCTAATTCCACGCTCCAGAAACAACCGGCGCCGAATTGAGTAAAC
TGGTTTCCCGGCGCCGGAGCTTCGTCGTCGATTACTTGTGCGATTGGAGAAGGATCCATG
TTGGTTTGTCTACTTGATCCTATACCTAGCTTGTTAAGTATGTTCATGGAGAAATTTTGT
AGAGAGAGCGAAACAGAGAAACAGAGGAAAGTGGTGAAGAGGAAACGTCGGCTGATTCTG
CGGAACATTTTGTACCAAATTCTGACAGGTATAAAATTCGCGTTTGCGTTTACGTTTTGA
ATAACGATAAAAATAATTTTAGAAACCAGTTTTGACATGATCAAATGGCTTCATGTCCGG
GAAATCTACATGGATCAGCAATGAGTAT

Last Updated on 07.07.2016 14:16