Sequences from confirmation amplicon


Confirmation sequences for line 653F03 and hit At1g66460 are shown.
Line ID 653F03
Locus At1g66460 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:24790385
Primers used for PCR DN29 - 8474, show primer details
   
Sequence Name 28-K101829-0022-653-F03C-8409
GenBank Accession LN498783 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K101829-0022-653-F03C-8409
ATTTACAATTGAATATATCCTGATATATTTAATTTTTAGCTTGACCAAAACCCGAATTTA
GTATGTCAAGTCACAAATTCGAATTGATGTATTGAGAAGCGTCCATTTATAGGAAAAGGG
GCTTGTGGAGTATAAGTGCTACAACTACCAAAAGTCAAATAGGTTGGTTTACTAGTAGTT
TATCAAGAAAATATACAAAAGTAAAATTACACTTACCCAAACTACCAAATTTTCTTCACC
AGATGGTCTTCTTGCTTCAATTGGCTTCCGACCAGTTATTAGCTCAAGCAACACGACTCC
AAATGCGTAAACATCGGTCTTGTCAGATATCTTGCCGTGTTGGAAATACTCAGGAGCCAG
ATAACTGCAAAAGTTTTCCAATTTATTGCGCACTTAACATCTATAGGTGTGACTTTATGG
CATCAAAAGGTTTATAAGTTAGATACCCAAAAGTTCCTTTCACGGTTTTACAGAGGAAAG
GAACCGAAGGCGCAGCGGTCCAAGTAGCCAACCCAAAATCACACAACTGAAAGAAAAACT
CCAACAGTGAATACAGAACACACTTATGTTGACAAATGACTAANGAGTGGTTCAAAGTCT
CTTTACCTTTGGAATTTGGTTTG
   
Sequence Name 72-K101832-0022-653-F03C-DN29
GenBank Accession LN512699 [GenBank]
Sequencing primer gene specific primer, DN29: 5'-CCTCAAACAAAATTCCAAAGGTAA-3'
Sequence (A. th genome BLAST matches underlined)
>72-K101832-0022-653-F03C-DN29
TCTGTATTCCTGTTGGAGTTTTTCTTTCGTTGTGTGATTTTGGGTTGGCTACTTGGACCG
CTGCGCCTTCGGTTCCTTTCCTCTGTAAAACCGTGAAAGGAACTTTTGGGTATCTAACTT
ATAAACCTTTTGATGCCATAAAGTCACACCTATAGATGTTAAGTGCGCAATAAATTGGAA
AACTTTTGCAGTTATCTGGCTCCTGAGTATTTCCAACACGGCAAGATATCTGACAAGACC
GATGTTTACGCATTTGGAGTCGTGTTGCTTGAGCTAATAACTGGTCGGAAGCCAATTGAA
GCAAGAAGACCATCTGGTGAAGAAAATTTGGTAGTTTGGGTAAGTGTAATTTTACTTTTG
TATATTTTCTTGATAAACTACTAGTAAACCAACCTATTTGACTTTTGGTAGTTGTAGCAC
TTATACTCCACAAGCCCCTTTTCCTATAAATGGACGCTTCTCAATACATCAATTCGAATT
TGTGACTTGACATACTAAATTCGGGTTTTGGTCAAGCTAAAAATTAAATATATCAGGATA
TATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGAT
GGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGA
TGTCCGCA

Last Updated on 23.10.2014 13:25