Sequences from confirmation amplicon


Confirmation sequences for line 658E02 and hit At4g26840 are shown.
Line ID 658E02
Locus At4g26840 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:13497725
Primers used for PCR AB12 - 8474, show primer details
   
Sequence Name 09-K024846-022-658-E02C-8409
GenBank Accession LN490014 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K024846-022-658-E02C-8409
TGTTTACACGTTTGCTTGTTTTTGCTAATTGTTTATCAAATTTCTGAAATTATATAAGTC
TTGTTTAGGTGTAAGTTGTTATTGAGCTTTTGGTTCCTGTTGTTGTTTGAGGGTTTTATA
GTTTTGGAAGGGATAAGTTTACTTAGTTGTTGAATGTTCTAAAGACTGTGAACGATGCTG
TCTCTGTACTAAGTTGTTATATATCTTCTGATGAAGTTGTAGTCTCTGTACTAAGTTTTC
AATTAGTTTGGCTGATGTTTGTGCTTCAAATTCTCATAGACGAAGCCTTAAACTGAATGT
TTGTTGATATGTGTTTAATTTTTCGACTCTTTCAGGTTACTACCAAAAGAGAGCCATGTG
ATTTAGTTATTGTTTCATATGCGGTCTCTAACGTTTATTGTTCCTTCTATATGTTTGTTT
TATAGGATGGAAACGAGGTTTTCTTTAGGATCAAGAGAAGCACTCAGCTCAAGAAGCTGA
TGAATGCTTACTGTGACCGGCAATCTGTGGACATGAACTCCATTGCTTTCTTGTTTGATG
GGCGTCGTCTTCGTGCTGAGCAAACTCCCGATG
   
Sequence Name 10-K024846-022-658-E02C-AB12
GenBank Accession LN490487 [GenBank]
Sequencing primer gene specific primer, AB12: 5'-ATGTTATACCTCATCGGGAGTTTG-3'
Sequence (A. th genome BLAST matches underlined)
>10-K024846-022-658-E02C-AB12
CACGAAGACGACGCCCATCAAACAAGAAAGCAATGGAGTTCATGTCCACAGATTGCCGGT
CACAGTAAGCATTCATCAGCTTCTTGAGCTGAGTGCTTCTCTTGATCCTAAAGAAAACCT
CGTTTCCATCCTATAAAACAAACATATAGAAGGAACAATAAACGTTAGAGACCGCATATG
AAACAATAACTAAATCACATGGCTCTCTTTTGGTAGTAACCTGAAAGAGTCGAAAAATTA
AACACATATCAACAAACATTCAGTTTAAGGCTTCGTCTATGAGAATTTGAAGCACAAACA
TCAGCCAAACTAATTGAAAACTTAGTACAGAGACTACAACTTCATCAGAAGATATATAAC
AACTTAGTACAGAGACAGCATCGTTCACAGTCTTTAGAACATTCAACAACTAAGTAAACT
TATCCCTTCCAAAACTATAAAACCCTCAAACAACAACAGGAACCAAAAGCTCAATAACAA
CTTACACCTAAACAAGACTTATATAATTTCAGAAATTTGATAAACAATTAGCAAAAACAA
GCAAACGTGTAAACATAAAGCAGCAATGAGTAT

Last Updated on 23.10.2014 13:25