Sequences from confirmation amplicon


Confirmation sequences for line 663F07 and hit At3g53520 are shown.
Line ID 663F07
Locus At3g53520 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:19842625
Primers used for PCR MP45 - 8474, show primer details
   
Sequence Name 15-K025266-022-663-F07C-8409
GenBank Accession LN492804 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K025266-022-663-F07C-8409
CCATGTAGACTTACTGTCTCTTTCTGTGGATGCTCAAGGGGATCTCCATAGACTTCACTT
GTGCTGGTGAGCAGAAACCTTGCCCCAACTCTCTTTGCAAGACCCAACATATTGAGAGTG
CCCATTACATTTGTCTTGTAAAACTATGGTTAAGGATCAACCAGAATCATCATATCAACA
ATAGAGAAAAACACATTCCCAATGGAAACATTTCATCACGAAATATCACAATAATTGTAA
GAGATTCTACTAAGCTGCACGTCAATTGTCAAATGCCTATCAACAGGATGCTAATAACAA
TGATCACCAACCTAATGTTGCCTAAATTTGTATAACGGATTTAGAATCAGAACTTGCAAA
TCACGACCCGTAATCAAAAGGATATGATAGTCTTGACTGGATTATACTTGTAATGAACAG
GTGAAGCTGGACAAGCTAAATGGTAAATCTGATCGACCTCAAGGAGGATTGGCTCAACAA
CATCGTGTCGAATTAGC
   
Sequence Name 16-K025266-022-663-F07C-MP45
GenBank Accession LN493273 [GenBank]
Sequencing primer gene specific primer, MP45: 5'-CCTAGGTTTGAGCTAATTCGACAC-3'
Sequence (A. th genome BLAST matches underlined)
>16-K025266-022-663-F07C-MP45
GTTGAGCCAATCCTCCTTGAGGTCGATCAGATTTACCATTTAGCTTGTCCAGCTTCACCT
GTTCATTACAAGTATAATCCAGTCAAGACTATCATATCCTTTTGATTACGGGTCGTGATT
TGCAAGTTCTGATTCTAAATCCGTTATACAAATTTAGGCAACATTAGGTTGGTGATCATT
GTTATTAGCATCCTGTTGATAGGCATTTGACAATTGACGTGCAGCTTAGTAGAATCTCTT
ACAATTATTGTGATATTTCGTGATGAAATGTTTCCATTGGGAATGTGTTTTTCTCTATTG
TTGATATGATGATTCTGGTTGATCCTTAACCATAGTTTTACAAGACAAATGTAATGGGCA
CTCTCAATATGTTGGGTCTTGCAAAGAGAGTTGGGGCAAGGTTTCTGCTCACCAGCACAA
GTGAAGTCTATGGAGATCCCCTTGAGCATCCACAGAAAGAGACAGTAAGTCTACATGGAT
CAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTC
AATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAAC
GACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGG
AAATCTTTATTTCGACGTGTCTAC

Last Updated on 23.10.2014 13:25