Sequences from confirmation amplicon


Confirmation sequences for line 684G11 and hit At1g13170 are shown.
Line ID 684G11
Locus At1g13170 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:4489246
Primers used for PCR CK74 - 8474, show primer details
   
Sequence Name 43-K026693-022-684-G11C-8409
GenBank Accession LN504708 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>43-K026693-022-684-G11C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATAACTCCTGGGATGATAGACAAAT
TGCCTCCAACAGATTCAAGACTGAGACCAGACCAAAGACACTTAGAAAACGGTGAATATG
AGTCAGCAAATGCCGAGAAACTGAGACTTGAACAGTTACAGAGACAGGTACAAAATCTAT
AGGAGAATATGTTAATCTTGACTATATACATAATTGTGCATGACCACAGGACTGAATATA
GAAGAGTGTGCCGTTTGTGTGTTGCAGGCAAGGAGGCTGCAGGAGAAAGGATGGAAACCA
AGATGGTTTGAAAAAGATGAAGAAGGAAATTATCGGTATCTAGGAGGTTACTGGGAAGCA
AGAGAGAAGAAAGATTGGGATAGAATCACTGACATTTTCAAGAAGCAACAACAGCGTAAC
TCGCTCTCATCTTCTTCATCGTCTACCTTTCTTTAATCATCAATTATCCCATGTTTTTTT
TTTGTGCTTTGATAATTTAATACATATAGAAAGAATCTTCACCATTCCCTCATTGTGCTT
CTGTGAAAATTTGGCCGGAACCTTTGTTGGTGTGCGTGTATCTGTAGATGTCAAAGAGAC
TAATTATTGGAAATGA
   
Sequence Name 47-K026693-022-684-G11C-CK74
GenBank Accession LN506075 [GenBank]
Sequencing primer gene specific primer, CK74: 5'-GAAGGAAAAATTCATCATTTCCAA-3'
Sequence (A. th genome BLAST matches underlined)
>47-K026693-022-684-G11C-CK74
TAATTAGTCTCTTTGACATCTACAGATACACGCACACCAACAAAGGTTCCGGCCAAATTT
TCACAGAAGCACAATGAGGGAATGGTGAAGATTCTTTCTATATGTATTAAATTATCAAAG
CACAAAAAAAAAACATGGGATAATTGATGATTAAAGAAAGGTAGACGATGAAAAAGATGA
GAGCGAGTTACGCTGTTGTTGCTTCTTGAAAATGTCAGTGATTCTATCCCAATCTTTCTT
CTCTCTTGCTTCCCAGTAACCTCCTAGATACCGATAATTTCCTTCTTCATCTTTTTCAAA
CCATCTTGGTTTCCATCCTTTCTCCTGCAGCCTCCTTGCCTGCAACACACAAACGGCACA
CTCTTCTATATTCAGTCCTGTGGTCATGCACAATTATGTATATAGTCAAGATTAACATAT
TCTCCTATAGATTTTGTACCTGTCTCTGTAACTGTTCAAGTCTCAGTTTCTCGGCATTTG
CTGACTCATATTCACCGTTTTCTAAGTGTCTTTGGTCTGGTCTCAGTCTTGAATCTGTTG
GAGGCAATTTGTCTATCATCCCAGGAGTTATTCAATTGTAAATGGCTTCATGTCCGGGAA
ATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTAC
CAATTTTTTTTCAATTCAAAAA

Last Updated on 23.10.2014 13:25