Sequences from confirmation amplicon


Confirmation sequences for line 695F02 and hit At3g04730 are shown.
Line ID 695F02
Locus At3g04730 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:1290456
Primers used for PCR NE15 - 8474, show primer details
   
Sequence Name 61-K102368-0022-695-F02C-8409
GenBank Accession LN510479 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>61-K102368-0022-695-F02C-8409
CTTTACATTGAATATATCCTGACCTAACTAATTACTCGTTGATAATCATTATATCGAGAA
ATATGATTAATTTTGAGGCCACGGAGCTGAGATTAGGGCTACCGGGTGGGAATCACGGAG
GAGAAATGGCTGGAAAAAATAATGGTAAAAGAGGATTTTCTGAGACTGTTGATCTCAAAC
TGAATCTTTCATCGACGGCTATGGATTCAGTTTCCAAAGTCGATTTAGAGAATATGAAGG
AGAAGGTCGTAAAACCACCAGCCAAGTAAGAAACTGAATTTCAATCTCTATTTCAACTAA
TAATATTGTCTTCTAGGTTCGGTAAAATTAGGTTATACTAGGCGGTCATTATGTAGAGAT
GTATACGCTTTAACATGATTTCTAGCTAGGTTAGGGAACTCGAACGGAATAATTATGCTG
ATACTTCTCCTAAGATCTTTGTTTTTTATTTGGTTTTGCTCCATGTTTCAATTGTAGTTA
GGTTGAGAGTCTGTTTGATTATTTTTTTGTCGGGAAGACTTAGAAAA
   
Sequence Name 61-K102369-0022-695-F02C-NE15
GenBank Accession LN510480 [GenBank]
Sequencing primer gene specific primer, NE15: 5'-TTTTTCTAGTTCTTCCCGACAAAA-3'
Sequence (A. th genome BLAST matches underlined)
>61-K102369-0022-695-F02C-NE15
TACATTGAAACTGGAGCAAAACCAAATAAAAAACAAAGATCTTAGGAGAAGTATCAGCAT
AATTATTCCGTTCGAGTTCCCTAACCTAGCTAGAAATCATGTTAAAGCGTATACATCTCT
ACATAATGACCGCCTAGTATAACCTAATTTTACCGAACCTAGAAGACAATATTATTAGTT
GAAATAGAGATTGAAATTCAGTTTCTTACTTGGCTGGTGGTTTTACGACCTTCTCCTTCA
TATTCTCTAAATCGACTTTGGAAACTGAATCCATAGCCGTCGATGAAAGATTCAGTTTGA
GATCAACAGTCTCAGAAAATCCTCTTTTACCATTATTTTTTCCAGCCATTTCTCCTCCGT
GATTCCCACCCGGTAGCCCTAATCTCAGCTCCGTGGCCTCAAAATTAATCATATTTCTCG
ATATAATGATTATCAACGAGTAATTAGTTAGGTCAGGATATATTCAATTGTAAATGGCTT
CATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGA
AAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAA
AATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGC
AATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCC

Last Updated on 23.10.2014 13:25