Sequences from confirmation amplicon


Confirmation sequences for line 700A12 and hit At2g18410 are shown.
Line ID 700A12
Locus At2g18410 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:7991306
Primers used for PCR BG30 - 8474, show primer details
   
Sequence Name 26-K101744-0022-700-A12C-8409
GenBank Accession LN497861 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K101744-0022-700-A12C-8409
ATTTACATTGAATATATCCTGAACCTTAATCAAACTTGAACCTTCACTAAAACTAGTTGA
AGATTGATCAATCCATCCCAATGGATCAGTGTAACAATCCAAAATACGAATCCTTCAAAT
CAAAACCAATTGTTATCAAACAAGTATCACAGTGATTCGAGCAATCAAACTACTCCACAA
GCTAGGATAATATTTAGAAAACCTAATAACTCACCATTTAGAAGATGAAGAGACAACGAT
TCCTTTTTGCTTCAACAATTGCAAATAGAACGAAGGGCTCCGCGAGAATGTGATCAACAC
AAGACCCCTGAATCGCAAAGTGGGAAAAACGAAGACTTTAGCAGTAATGAAGCAATTGGA
GATCGAATATAGAAGAATTAGGGTTTAAGAGTATACTGCGACGAGGATTTTCCAGCTAAA
ATTGAAGAAGATAGATTTGTGAGAAGATAGCCGGAGACATCGAGTCCGAAAGGGGAAGCT
ACAGTTTCTTCTATAGTGAGAGCTGGTGCGAGTTCGCCTTCTTCGCCACCATCTCTGAGC
TTTCTGAAAATCGATTCCGCCATTGTTGAGAGATTCTAGAGCTCTCCGGTCAAAAGAGCG
GCGAGGAAACAAAACATCGAAAAGTTAAAAAGGGCTTTTGGGCTTTATGATGTAGCCCAC
TGGGCTTTGTTCAAAGAAACACTCGT
   
Sequence Name 26-K101750-0022-700-A12C-BG30
GenBank Accession LN497862 [GenBank]
Sequencing primer gene specific primer, BG30: 5'-TTTATTCCTCCAACGAGTGTTTCT-3'
Sequence (A. th genome BLAST matches underlined)
>26-K101750-0022-700-A12C-BG30
TCATAAGCCCAAAGCCCTTTTTACTTTTCGATGTTTTGTTTCCTCGCCGCTCTTTTGACC
GGAGAGCTCTAGAATCTCTCAACAATGGCGGAATCGATTTTCAGAAAGCTCAGAGATGGT
GGCGAAGAAGGCGAACTCGCACCAGCTCTCACTATAGAAGAAACTGTAGCTTCCCCTTTC
GGACTCGATGTCTCCGGCTATCTTCTCACAAATCTATCTTCTTCAATTTTAGCTGGAAAA
TCCTCGTCGCAGTATACTCTTAAACCCTAATTCTTCTATATTCGATCTCCAATTGCTTCA
TTACTGCTAAAGTCTTCGTTTTTCCCACTTTGCGATTCAGGGGTCTTGTGTTGATCACAT
TCTCGCGGAGCCCTTCGTTCTATTTGCAATTGTTGAAGCAAAAAGGAATCGTTGTCTCTT
CATCTTCTAAATGGTGAGTTATTAGGTTTTCTAAATATTATCCTAGCTTGTGGAGTAGTT
TGATTGCTCGAATCACTGTGATACTTGTTTGATAACAATTGGTTTTGATTTGAAGGATTC
GTATTTTGGATTGTTACACTGATCCATTGGGATGGATTGATCAATCTTCAACTAGTTTTA
GTGAAGGTTCAAGTTTGATTAAGGTTCAGGATATATTCAATTGTAAATGGCTTCATGTCC
GGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAANAAGAAAGAGTA
ATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCC

Last Updated on 23.10.2014 13:25