Sequences from confirmation amplicon


Confirmation sequences for line 705H11 and hit At3g14595 are shown.
Line ID 705H11
Locus At3g14595 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:4909559
Primers used for PCR NE06 - 8474, show primer details
   
Sequence Name 11-K102429w-0022-705-H11C-8409
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K102429w-0022-705-H11C-8409
TTACGTCTTACAATTTGACAAATGATTTTTTTGCTTAGTATTTTGAACATTGTGGATTCA
TTTGGAAACAAACATCAGAATCTCTTATCTCATCTGCCAAAATTTCTAGCTAAACTGTAG
TTTCTCAAAAGGATTGTATCATTATTGCAACGTACACACACCACTTGGCTGTTCTAAAGC
TCGTTTTGGTTATCTCTAGTTTTCATCAACTATAGTCTTTGGTCGCAGGTTATGTTGTTA
ATGGAGTAAGACCAACAGAACACGGTCGTTGTTGCGGTATCGGCATTGGCTGGGTATTGT
AAGTGATCTTTATCATTTATTTTTACCTAACTTCTCTTCTCATTACATTCTTGATAATTT
TTGAGAGTTTTTTTTGGTTTGATGTGTCTTGAAGATTCATCCTTGGTTTCTTCTTCGCTT
TGCCCTGGTACATCGGTTTCTTCCTTCTATTATTCTCTAGGAACCCGCGTGAGAGACC
   
Sequence Name 27-K102430-0022-705-H11C-NE06
GenBank Accession LN498329 [GenBank]
Sequencing primer gene specific primer, NE06: 5'-GCTATATATCCTGGTCTCTCACGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K102430-0022-705-H11C-NE06
TACCAGGGCAAAGCGAAGAAGAACCAAGGATGAATCTTCAAGACACATCAAACCAAAAAA
AACTCTCAAAAATTATCAAGAATGTAATGAGAAGAGAAGTTAGGTAAAAATAAATGATAA
AGATCACTTACAATACCCAGCCAATGCCGATACCGCAACAACGACCGTGTTCTGTTGGTC
TTACTCCATTAACAACATAACCTGCGACCAAAGACTATAGTTGATGAAAACTAGAGATAA
CCAAAACGAGCTTTAGAACAGCCAAGTGGTGTGTGTACGTTGCAATAATGATACAATCCT
TTTGAGAAACTACAGTTTAGCTAGAAATTTTGGCAGATGAGATAAGAGATTCTGATGTTT
GTTTCCAAATGAATCCACAATGTTCAAAATACTAAGCAAAAAAATCATTTGTCAAATTGT
AAGACGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTC
AATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTC
CGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGT
ATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGT
CTACATTC

Last Updated on 07.07.2016 14:16