Sequences from confirmation amplicon


Confirmation sequences for line 713E09 and hit At1g25470 are shown.
Line ID 713E09
Locus At1g25470 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:8945555
Primers used for PCR NE02 - 8474, show primer details
   
Sequence Name 50-K102433-0022-713-E09C-8409
GenBank Accession LN507121 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>50-K102433-0022-713-E09C-8409
TTTACATTGAATATATCCTGTAAATTTCATTAATAGGCAGATCAAGTTTACTGATAGAGG
CAATTTAAAAAAGGATTTCATCAAGTTTGAGAAATTTTATTGATAGAAGGAAATCTACTA
GGCAGTTTAAGTATCCTGTGGGAGTTAGGCCGAGGCCATCAGGCAAATTTGCTGCTGAGA
TTTTGAACCCATTCACTAAAACTAAGAAATGGTTGGGTACTTATGAAACTCCTGCAGAAG
CTGAGAAGGCTTATGTTGACAAGAAGGTTGAGTATGATGCACTGGCTTCTTCAGGTTCTG
CTGTTTCCTCATCGGTTGTAACAGTGACTAGCCAGTGCTTGCGTTCCCCTACTTCTGCTT
CTGTTTCTTGTGTAAGTGCTGATGATTTGTCTAAAGAAAAGACGTCTCTGAACAAAGATG
TTGCTGCGTCTGGTGATTCAACCACCAAAGAAGTGTTCACTACTTTC
   
Sequence Name 50-K102434-0022-713-E09C-NE02
GenBank Accession LN507122 [GenBank]
Sequencing primer gene specific primer, NE02: 5'-ATCCGAAAAGTCGAAAGTAGTGAA-3'
Sequence (A. th genome BLAST matches underlined)
>50-K102434-0022-713-E09C-NE02
CACATCTTTGTTCGAGACGTCTTTTCTTTAGACAAATCATCAGCACTTACACAAGAAACA
GAAGCAGAAGTAGGGGAACGCAAGCACTGGCTAGTCACTGTTACAACCGATGAGGAAACA
GCAGAACCTGAAGAAGCCAGTGCATCATACTCAACCTTCTTGTCAACATAAGCCTTCTCA
GCTTCTGCAGGAGTTTCATAAGTACCCAACCATTTCTTAGTTTTAGTGAATGGGTTCAAA
ATCTCAGCAGCAAATTTGCCTGATGGCCTCGGCCTAACTCCCACAGGATACTTAAACTGC
CTAGTAGATTTCCTTCTATCAATAAAATTTCTCAAACTTGATGAAATCCTTTTTTAAATT
GCCTCTATCAGTAAACTTGATCTGCCTATTAATGAAATTTACAGGATATATTCAATTGTA
AATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGA
GAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGT
TATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAG
GCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 23.10.2014 13:25