Sequences from confirmation amplicon


Confirmation sequences for line 715A09 and hit At5g03580 are shown.
Line ID 715A09
Locus At5g03580 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:907588
Primers used for PCR NE01 - 8474, show primer details
   
Sequence Name 53-K102433-0022-715-A09C-8409
GenBank Accession LN508109 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>53-K102433-0022-715-A09C-8409
CCATTTACAATTGAATATTTATTTGTAGATTTTGTTATTTTTTTCATTAGTCATTAGTCA
AAACTTGTAGTCAATCTTTTTAGTAAATAAATTTAATTTTATTTGAATACACATTTGTTG
ATAAAAAAAAGAAAAAAAGAATACATATCTACCTTTTGCTATTTGAATACACATTTATTC
TATCGTCTTCTTGTGTAACAGAGCTAAAGATGAGCAACGATGATAATCACGGATCGTCTT
CTTGTCCAAGAAAATTTACGAGTTTGTATATAGCAAATCTTGATGCCCAAGTCTCTGAAG
AAATGTTGTTTCTGATGTTTTCGGATTTCGGAAAGGTTATAAGATCAGTTCTAGCAAAAG
ATTTTAGAGGAGAGTCGCGAGGATTTGCTTTCATTGAGTTTGAAAGTGCGGATAGTGCTG
GACGAGCCATGCTTCATATGGACGGAAGGTTAATAGGTAAAAACATTTCAAGTTTTTGGT
TGAGTTAGTTTATATATATGAAGAACAAAAATACAAAGGTGACCAAATANCCAAATCA
   
Sequence Name 53-K102434-0022-715-A09C-NE01
GenBank Accession LN508110 [GenBank]
Sequencing primer gene specific primer, NE01: 5'-CTGATTTGGTATTTTGGTCACCTT-3'
Sequence (A. th genome BLAST matches underlined)
>53-K102434-0022-715-A09C-NE01
CTCACCAAAACTTGAAATGTTTTTACCTATTAACCTTCCGTCCATATGAAGCATGGCTCG
TCCAGCACTATCCGCACTTTCAAACTCAATGAAAGCAAATCCTCGCGACTCTCCTCTAAA
ATCTTTTGCTAGAACTGATCTTATAACCTTTCCGAAATCCGAAAACATCAGAAACAACAT
TTCTTCAGAGACTTGGGCATCAAGATTTGCTATATACAAACTCGTAAATTTTCTTGGACA
AGAAGACGATCCGTGATTATCATCGTTGCTCATCTTTAGCTCTGTTACACAAGAAGACGA
TAGAATAAATGTGTATTCAAATAGCAAAAGGTAGATATGTATTCTTTTTTTCTTTTTTTT
ATCAACAAATGTGTATTCAAATAAAATTAAATTTATTTACTAAAAAGATTGACTACAAGT
TTTGACTAATGACTAATGAAAAAAATAACAAAATCTACAAATAAATATTCAATTGTAAAT
GGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAA
AAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTAT
TATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCG
AAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCA

Last Updated on 23.10.2014 13:25