Sequences from confirmation amplicon


Confirmation sequences for line 722B02 and hit At2g05080 are shown.
Line ID 722B02
Locus At2g05080 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:1809090
Primers used for PCR NF12 - 8474, show primer details
   
Sequence Name 03-K102427-0022-722-B02C-8409
GenBank Accession LN487432 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>03-K102427-0022-722-B02C-8409
GCCATTTACACACTTTCCTTCCTCTGAAGCCTTTTGCACGGAATTGTAATTATCTGCCCT
CAAACTACTCTGGTTAAGTTTGATGTAACCAAGCCGGTTTGATTCTATTGCTATATAAGA
ATCCACCAAGAATTGCTGCCATAGCCTTTTGGACCTAAGTAAAATATGCTTCTCATGTTT
CCTTTCGTGAATTCTGAAGGCAAACCATTGCCTTATAGATATGAACTTGTTCTTCTTATC
TTTACCAGCCCCTGTTTGATGTTTCTCAATTCCTGTTCTGAATCCATCTTCACCATAAGG
GAACAAAAGAGGATATTGTAGAGGAAGATAACACGGGAGAATTTCACTAATTCTTTGTAG
TTTCCCTGATTTCTCTTCCACTATTATATCTCTGCATGGTATATCTATAGTGAAGTCTCC
AGGAATTAACATGGCTACCTCTGATGTCGTTGGTACATTATACACCCTGCCNTCAGTTT
   
Sequence Name 03-K102428-0022-722-B02C-NF12
GenBank Accession LN487433 [GenBank]
Sequencing primer gene specific primer, NF12: 5'-GAAACTGATGGCAGGGTGTATAAT-3'
Sequence (A. th genome BLAST matches underlined)
>03-K102428-0022-722-B02C-NF12
TATTCCTGGAGACTTCACTATAGATATACCATGCAGAGATATAATAGTGGAAGAGAAATC
AGGGAAACTACAAAGAATTAGTGAAATTCTCCCGTGTTATCTTCCTCTACAATATCCTCT
TTTGTTCCCTTATGGTGAAGATGGATTCAGAACAGGAATTGAGAAACATCAAACAGGGGC
TGGTAAAGATAAGAAGAACAAGTTCATATCTATAAGGCAATGGTTTGCCTTCAGAATTCA
CGAAAGGAAACATGAGAAGCATATTTTACTTAGGTCCAAAAGGCTATGGCAGCAATTCTT
GGTGGATTCTTATATAGCAATAGAATCAAACCGGCTTGGTTACATCAAACTTAACCAGAG
TAGTTTGAGGGCAGATAATTACAATTCCGTGCAAAAGGCTTCAGAGGAAGGAAAGTGTGT
AAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGG
AGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCG
TTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATA
GGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATT
CA

Last Updated on 23.10.2014 13:25