Sequences from confirmation amplicon


Confirmation sequences for line 726G02 and hit At5g27210 are shown.
Line ID 726G02
Locus At5g27210 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:9572559
Primers used for PCR NF56 - 8474, show primer details
   
Sequence Name 17-K102500-0022-726-G02C-8409
GenBank Accession LN493799 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K102500-0022-726-G02C-8409
GCCATTTACATTGAATAATCCTGCAAGTATTTTGAGTTAAAAGCCATATACAAGCTGAAC
ATAAGACAATATTCTCTGTTGGGATGGTTTCAGATAAGAGTTACCAGAAACCAAAATGCG
CGTTGTTTGCGGTAAACGCAGATGCAACTAGGTAAAGGCTGTATAAGGCGAACATGATGA
TTATGTAGTTGTAGAATGCAGGCCTTGCTGTTAGAAACAAGAAGACATGAATGATGATAA
ATAGAAAGAAACCAGTGGAGGCTATTATGGGAAGATAGAAGCGTCTGATCAACTTACCAG
GCAATTTTTCTCTCCACCTAGAGTTGTACATCAAGAACACCATCCCATAAACGCCAGTGA
GTAGAAGCTTATGAATGATCCATAAGCCCCATTTGAACGTTTTTCCATTTTCATTGTTGT
CAATAAACAATGGCACTCCAAATCCAAAGAGAAAAATTGCCTGAATGAAGGTAAAACCCG
TAAGGAC
   
Sequence Name 17-K102501-0022-726-G02C-NF56
GenBank Accession LN493800 [GenBank]
Sequencing primer gene specific primer, NF56: 5'-AGTCCTTACGGGTTTTACCTTCAT-3'
Sequence (A. th genome BLAST matches underlined)
>17-K102501-0022-726-G02C-NF56
TTTATTGACACAATGAAAATGGAAAAACGTTCAAATGGGGCTTATGGATCATTCATAAGC
TTCTACTCACTGGCGTTTATGGGATGGTGTTCTTGATGTACAACTCTAGGTGGAGAGAAA
AATTGCCTGGTAAGTTGATCAGACGCTTCTATCTTCCCATAATAGCCTCCACTGGTTTCT
TTCTATTTATCATCATTCATGTCTTCTTGTTTCTAACAGCAAGGCCTGCATTCTACAACT
ACATAATCATCATGTTCGCCTTATACAGCCTTTACCTAGTTGCATCTGCGTTTACCGCAA
ACAACGCGCATTTTGGTTTCTGGTAACTCTTATCTGAAACCATCCCAACAGAGAATATTG
TCTTATGTTCAGCTTGTATCTGCCTTTTAACTCAAAATACTTGCAGGATATATTCAATTG
TAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATG
GAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGC
GTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTAT
AGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACAT
TCACTCCCAAATG

Last Updated on 07.07.2016 14:16