Sequences from confirmation amplicon


Confirmation sequences for line 726G07 and hit At1g07000 are shown.
Line ID 726G07
Locus At1g07000 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:2151609
Primers used for PCR DN39 - 8474, show primer details
   
Sequence Name 37-K101830-0022-726-G07C-8409
GenBank Accession LN502562 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>37-K101830-0022-726-G07C-8409
ATTTACATTGAATATATCCTGCAATCGATCTAAGCCATTTTCGTCGCTGGTGGATTTGCA
AAAGAGTGTTCAAGAGTGTACAGCAGTCGACGAAGAGAGTTTCTAGAGGAGAGTTTGTCG
AGGTTACATCTCAGAGGACTAAGTATGGAGGAAGTGCAAGAGAGTCCATGGCAAGATCTT
GAAGACGAAATCGACCGTTGGATTAAAGCCGTAACGCTGATATTCCACGTTTTCTTCCCG
AGCGAGCGTCTTCTCTGCGATCGCGTTTTCTCTGATCTTCCTGTTTCCTCTGTAACCGAT
CTTTCTTTCATGGAAGTTTGTCGCGGAACCACAACACAGCTTCTGAATTTCGCAGACGCG
ATCGCTTTAGGAAGCCGTTTACCTGAACGTTTGTTTAAGGTTGTGGATTTATACGAAGCG
ATGCAAGACCTTATTCCTAAGATGGAAACGCTATTTTCTGATCGATATTGTTCGCCGCTA
AGGCATGAGGCGCTCGCGATTCATAAACGGTTAGGAGAAGCGANAAGAGGGA
   
Sequence Name 81-K101833-0022-726-G07C-DN39
GenBank Accession LN514049 [GenBank]
Sequencing primer gene specific primer, DN39: 5'-ATCCCTCTAATCGCTTCTCCTAAC-3'
Sequence (A. th genome BLAST matches underlined)
>81-K101833-0022-726-G07C-DN39
GGCGACAATATCGATCAGAAAATAGCGTTTCCATCTTAGGAATAAGGTCTTGCATCGCTT
CGTATAAATCCACAACCTTAAACAAACGTTCAGGTAAACGGCTTCCTAAAGCGATCGCGT
CTGCGAAATTCAGAAGCTGTGTTGTGGTTCCGCGACAAACTTCCATGAAAGAAAGATCGG
TTACAGAGGAAACAGGAAGATCAGAGAAAACGCGATCGCAGAGAAGACGCTCGCTCGGGA
AGAAAACGTGGAATATCAGCGTTACGGCTTTAATCCAACGGTCGATTTCGTCTTCAAGAT
CTTGCCATGGACTCTCTTGCACTTCCTCCATACTTAGTCCTCTGAGATGTAACCTCGACA
AACTCTCCTCTAGAAACTCTCTTCGTCGACTGCTGTACACTCTTGAACACTCTTTTGCAA
ATCCACCAGCGACGAANATGGCTTAGATCGATTGCAGGATATATTCAATTGTAAATGGCT
TCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAG
AAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCG

Last Updated on 23.10.2014 13:25