Sequences from confirmation amplicon


Confirmation sequences for line 756B11 and hit At2g14740 are shown.
Line ID 756B11
Locus At2g14740 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:6312214
Primers used for PCR JG45 - 8474, show primer details
   
Sequence Name 10-K033879-022-756-B11C-8409
GenBank Accession LN490553 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>10-K033879-022-756-B11C-8409
TGAAGCCATTTACAATTGGCTGGAATACTCATTGGGTAATTACATGAAGCCATTATGGCT
GTAAAACCAGGGGCATAGGAATGTTAAAACAATTTTCCCCAAGTAACGGATATGGCAAAT
ACAAGATTAATCTTCGCTATTAACACAACAGAAAACAAAAGAGCAGAAGAGATTAAAAAA
GCTTACCCTTAGCCTATATTTGTAAACGAGGTATGCACCAGCAGCTGCAAGTCCCAATGA
TAACATTATAAGCCAAACGGCCGCCCATGCTGATCTCACTTGTGCACCCGTCTTGCCTAG
ATTTCGACAAATAGAACCAATAACAATTGGAAAACAGGTGGGAGAAACACTATTTGAATA
ATCAAACTTTAGACTTCCATATTCAAAAAAAAATACTCACTGATGCAAGTGTCATGATCT
CTGATGTAGAGAAGGTCCCCGCTACAAGAGCACTCATAGCTTCCCCATGTGTTCTTGCAG
CTACACTCTGGGCACTGGCATGCTTTCTTCTCTTTGCACTCATTAATGTCTGGTGCAGGA
AGCACGAAAATCCTTATAAGATGATTAGAACTAGAACAAAGTAGTACTGTAATTCAAGTT
TTTTCAGAGGGTCTAACTTCCCACACTTCAAACTGATATCCGGAAGGG
   
Sequence Name 66-K033879-022-756-B11C-JG45
GenBank Accession LN511537 [GenBank]
Sequencing primer gene specific primer, JG45: 5'-GAAGTGTGAAGGTTAGACCCTCTG-3'
Sequence (A. th genome BLAST matches underlined)
>66-K033879-022-756-B11C-JG45
TTGTTCTAGTTCTAATCATCTTATAAGGATTTTCGTGCTTCCTGCACCAGACATTAATGA
GTGCAAAGAGAAGAAAGCATGCCAGTGCCCAGAGTGTAGCTGCAAGAACACATGGGGAAG
CTATGAGTGCTCTTGTAGCGGGGACCTTCTCTACATCAGAGATCATGACACTTGCATCAG
TGAGTATTTTTTTTTGAATATGGAAGTCTAAAGTTTGATTATTCAAATAGTGTTTCTCCC
ACCTGTTTTCCAATTGTTATTGGTTCTATTTGTCGAAATCTAGGCAAGACGGGTGCACAA
GTGAGATCAGCATGGGCGGCCGTTTGGCTTATAATGTTATCATTGGGACTTGCAGCTGCT
GGTGCATACCTCGTTTACAAATATAGGCTAAGGGTAAGCTTTTTTAATCTCTTCTGCTCT
TTTGTTTTCTGTTGTGTTAATAGCGAAGATTAATCTTGTATTTGCCATATCCGTTACTTG
GGGAAAATTGTTTTAACATTCCTATGCCCCTGGTTTTACAGCCATAATGGCTTCATGTAA
TTACCAATGAGTATTCCAGCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATC
AGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCA
ATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACG
ACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGA
AATCTTTATTTCGACGTGTCTACATTC

Last Updated on 23.10.2014 13:25