Sequences from confirmation amplicon


Confirmation sequences for line 787D11 and hit At5g07420 are shown.
Line ID 787D11
Locus At5g07420 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:2349723
Primers used for PCR NF20 - 8474, show primer details
   
Sequence Name 14-K102429w-0022-787-D11C-8409
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K102429w-0022-787-D11C-8409
CATTTACAATTGAAGCTTCAGTTCGGGGTCTAGCGTGCCCCGTCTCTGGGAAAAGGGTTT
AACGTTGGCCATGAACCATTGTGGGATTTGGGCTCTGTCTGCCGGAATTGGGGTTATATC
GTCGGCGAGAACCACCGGCGAGGCAAAAAATACAAGTAATGCAACTAGGGCTAGAGATAT
GTAACCCATCTTTATTAATTTATTAATTTTTAAGTTTTTTTTTAAAGTAAAAGAAAATAA
AAGAAAAAAAGATATTTATTAATTTGGGAATAAAAATGGAAGAGATGAAGAAGCCTTGAA
GGGACATTTTATATACTTGCAGTGGTCGGGATCGTCGATGCATGACCGGATAGATCTCTT
TTTACTATTCTCGTGTGTGGTATTTTTTTCTTTTGCATTCTCATTTGTG
   
Sequence Name 30-K102430-0022-787-D11C-NF20
GenBank Accession LN499661 [GenBank]
Sequencing primer gene specific primer, NF20: 5'-CACAAATGAGAATGCAAAAGAAAA-3'
Sequence (A. th genome BLAST matches underlined)
>30-K102430-0022-787-D11C-NF20
AAAGAGATCTATCCGGTCATGCATCGACGATCCCGACCACTGCAAGTATATAAAATGTCC
CTTCAAGGCTTCTTCATCTCTTCCATTTTTATTCCCAAATTAATAAATATCTTTTTTTCT
TTTATTTTCTTTTACTTTAAAAAAAAACTTAAAAATTAATAAATTAATAAAGATGGGTTA
CATATCTCTAGCCCTAGTTGCATTACTTGTATTTTTTGCCTCGCCGGTGGTTCTCGCCGA
CGATATAACCCCAATTCCGGCAGACAGAGCCCAAATCCCACAATGGTTCATGGCCAACGT
TAAACCCTTTTCCCAGAGACGGGGCACGCTAGACCCCGAACTTGAAGCTTCAATTGTAAA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTA
TTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGC
GAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCAC

Last Updated on 07.07.2016 14:16