Sequences from confirmation amplicon


Confirmation sequences for line 793C12 and hit At2g17740 are shown.
Line ID 793C12
Locus At2g17740 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:7707624
Primers used for PCR NF35 - 8474, show primer details
   
Sequence Name 37-K102431-0022-793-C12C-8409
GenBank Accession LN502567 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>37-K102431-0022-793-C12C-8409
TTTACAATTGAATATATCCTGATCACCCTTTGATCCTCCTCTATTCCCCACAGAATAATA
ATTCAACGTATACTTGTGACGCATGCGGTGAGTATGGATCGGGGTTCACTTACAATTGTT
CTATCTGCCAGTACGATGTTCATGTTGGATGTGTGTCTGTGCCTGAGACCATGAAGCATG
ATGAGCACGTTCACCCGCTCGCTTTGATCTACAAGGCTCCATGCCCAAAGGATCATATAT
TTACCTGCGATGTTTGCGATGAAACTATGCCGCATAATCTGTGGTTGTACTACTGCCAGA
AATGTGACTACGGTGCTCATTTACATTC
   
Sequence Name 37-K102432-0022-793-C12C-NF35
GenBank Accession LN502568 [GenBank]
Sequencing primer gene specific primer, NF35: 5'-TGAATGTAAATGAGCACCGTAGTC-3'
Sequence (A. th genome BLAST matches underlined)
>37-K102432-0022-793-C12C-NF35
AGATTAGCGGCATAGTTTATCGCAACATCGCAGGTAAATATATGATCCTTTGGGCATGGA
GCCTTGTAGATCAAAGCGAGCGGGTGAACGTGCTCATCATGCTTCATGGTCTCAGGCACA
GACACACATCCAACATGAACATCGTACTGGCAGATAGAACAATTGTAAGTGAACCCCGAT
CCATACTCACCGCATGCGTCACAAGTATACGTTGAATTATTATTCTGTGGGGAATAGAGG
AGGATCAAAGGGTGATCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTA
CATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATT
TTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTG
ATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCT
AATTCGGAAATCTTTATTTCGACGTGTCTACATTCACTCCCAAATGG

Last Updated on 07.07.2016 14:16