Sequences from confirmation amplicon


Confirmation sequences for line 797D03 and hit At3g59030 are shown.
Line ID 797D03
Locus At3g59030 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:21819715
Primers used for PCR MZ76 - 8474, show primer details
   
Sequence Name 31-K026485-022-797-D03C-8409
GenBank Accession LN500008 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>31-K026485-022-797-D03C-8409
TTTACAATTGAATATATCCTGCAGCTGCAAGGTGCAAGACCATGGCTCGTTGGCAGATTA
TTCCCATTGATGAGTACTGTCTCGCTCCGTACGCTTGACCACACACTGTTTGGACCGCGC
TCGCCATTCCTAACTAGTCAATTTGATTAACAAAACTTTTTAAAACTCAAGAATGTTCGA
TAAGGAGAAACCGATCAACATATGAAGTGTACAATAAATATAGAATTAAACGACGTTGTT
TCGTGTTCTTCACTCTGTTTTTTACTTTATGAACTCAAATGTGCCTTCGTACCATGATAC
CGTAAGCTAGGCCTTGGATTCCGACGGTGGCGATGGAAGCGCCGGCGAGCTGAAGAGAAC
CGAGATGACCGGTGAACATGACGGTGACGAAGCTGAGCATGTAATTCAG
   
Sequence Name 32-K026485-022-797-D03C-MZ76
GenBank Accession LN500432 [GenBank]
Sequencing primer gene specific primer, MZ76: 5'-TGGTCTCTGTTCTGAATTACATGC-3'
Sequence (A. th genome BLAST matches underlined)
>32-K026485-022-797-D03C-MZ76
GCTTCGTCACCGTCATGTTCACCGGTCATCTCGGTTCTCTTCAGCTCGCCGGCGCTTCCA
TCGCCACCGTCGGAATCCAAGGCCTAGCTTACGGTATCATGGTACGAAGGCACATTTGAG
TTCATAAAGTAAAAAACAGAGTGAAGAACACGAAACAACGTCGTTTAATTCTATATTTAT
TGTACACTTCATATGTTGATCGGTTTCTCCTTATCGAACATTCTTGAGTTTTAAAAAGTT
TTGTTAATCAAATTGACTAGTTAGGAATGGCGAGCGCGGTCCAAACAGTGTGTGGTCAAG
CGTACGGAGCGAGACAGTACTCATCAATGGGAATAATCTGCCAACGAGCCATGGTCTTGC
ACCTTGCAGCTGCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATG
GATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTT
TTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAA
AACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATT
CGGAAATCTTTATTTCGACGTGTCTACATTCA

Last Updated on 07.07.2016 14:16