Sequences from confirmation amplicon


Confirmation sequences for line 803H10 and hit At5g15980 are shown.
Line ID 803H10
Locus At5g15980 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:5214448
Primers used for PCR MA63 - 8474, show primer details
   
Sequence Name 88-K102508-0022-803-H10C-8409
GenBank Accession LN514852 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>88-K102508-0022-803-H10C-8409
GCCATTTAAATTCAATTCATATATCAGTGTTATTATTACTCTTTCTTACAATTTTATTTG
TTTATACCAAAAATGGTAATGCTTTGACGGATTCCTTGCTGAAATCTGTCTTAAAGTCCT
TGAGAAGCGTGGATAGGGTTGAACAGAGCAATGAGCTGTTGAAAGAAATGAAGAGAGGAG
GCTATGTTCCTAGTGGTGATATGCAGAGCATGATTGCATCAAGTCTTAGTCGTAAGGGAA
AGAAGGACGAAGCTGATGAATTTGTAGACTTTATGGAATCATCCGGAAACAATCTAGATG
ACAAGGCAATGGCGTCTCTTGTTGAAGGGTATTGTGATTCCGGGAATCTTGATGAAGCTT
TAGTGTGTTTCGAGAAAATGGTTGGAAACACGGGAGTCTCCTATGCTGATTATTCATTTG
AGAAGTTGGTTCTTGCTTATTGCAACAAGAATCAAGTAAGAGATGCATACAAGCTTTTGA
GTGCACAAGTAACGAAAAATCAACTGAAACCTCGTCATAGCACATACAAAAGCTTGGTGA
CGAATCTGTTGA
   
Sequence Name 88-K102509-0022-803-H10C-MA63
GenBank Accession LN514853 [GenBank]
Sequencing primer gene specific primer, MA63: 5'-AATCTTCTTCGTCAACAGATTCGT-3'
Sequence (A. th genome BLAST matches underlined)
>88-K102509-0022-803-H10C-MA63
TGATTTTTCGTTACTTGTGCACTCAAAAGCTTGTATGCATCTCTTACTTGATTCTTGTTG
CAATAAGCAAGAACCAACTTCTCAAATGAATAATCAGCATAGGAGACTCCCGTGTTTCCA
ACCATTTTCTCGAAACACACTAAAGCTTCATCAAGATTCCCGGAATCACAATACCCTTCA
ACAAGAGACGCCATTGCCTTGTCATCTAGATTGTTTCCGGATGATTCCATAAAGTCTACA
AATTCATCAGCTTCGTCCTTCTTTCCCTTACGACTAAGACTTGATGCAATCATGCTCTGC
ATATCACCACTAGGAACATAGCCTCCTCTCTTCATTTCTTTCAACAGCTCATTGCTCTGT
TCAACCCTATCCACGCTTCTCAAGGACTTTAAGACAGATTTCAGCAAGGAATCCGTCAAA
GCATTACCATTTTTGGTATAAACAAATAAAATTGTAAGAAAGAGTAATAATAACACTGAT
ATATTGAATTGAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAG
TATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAA
TGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTAC
GATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTAT
TTCGACGTGTCTACATT

Last Updated on 23.10.2014 13:25