Sequences from confirmation amplicon


Confirmation sequences for line 851A02 and hit At1g27610 are shown.
Line ID 851A02
Locus At1g27610 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:9607563
Primers used for PCR NR86 - 8474, show primer details
   
Sequence Name 27-K102512-0022-851-A02C-8409
GenBank Accession LN498332 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K102512-0022-851-A02C-8409
CCATGTAGTTCTTCTTTCAAGCAACTATCAACCAGAAGAAGATTCCTACAAACCCTTCTC
CACTAAGGATGAGAAGTGGATCCGCGAGGAATTCAACAAAAAAGAAGAAGATCCTAAGAA
GCTCTTCGAGCTTTTCAAGGTATGTGCTTATATGATTATCATTTATAGGACTTTCTTAGG
TTTTGGATTACATTTTTTTGCTTTCTGCTATATTATCGGGTTATTGCTCAAATTTTATGG
ATTTGTACACCTATGTGGTGTGTAGGCTTCAGAGTACCTTGGATTTGTACATCCAAGTCG
TTTGATCAGAAGGATGGAGACGAAGAACAGTATATTCATCACATTTATTTATAATCCTTC
ATTAATGACGGGTTCATGGACGAACTACCTACGAAGCCCTCCAATGAAAGGCTTATGCTA
C
   
Sequence Name 46-K102513-0022-851-A02C-NR86
GenBank Accession LN505828 [GenBank]
Sequencing primer gene specific primer, NR86: 5'-AAGTAGCATAAGCCTTTCATTGGA-3'
Sequence (A. th genome BLAST matches underlined)
>46-K102513-0022-851-A02C-NR86
CCCGTCATTATGAAGGATTATAAATAAATGTGATGAATATACTGTTCTTCGTCTCCATCC
TTCTGATCAAACGACTTGGATGTACAAATCCAAGGTACTCTGAAGCCTACACACCACATA
GGTGTACAAATCCATAAAATTTGAGCAATAACCCGATAATATAGCAGAAAGCAAAAAAAT
GTAATCCAAAACCTAAGAAAGTCCTATAAATGATAATCATATAAGCACATACCTTGAAAA
GCTCGAAGAGCTTCTTAGGATCTTCTTCTTTTTTGTTGAATTCCTCGCGGATCCACTTCT
CATCCTTAGTGGAGAAGGGTTTGTAGGAATCTTCTTCTGGTTGATAGTTGCTTTGAAAGA
AGAACTACATGGCTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTAT
GATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGT
AGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGAT
CCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTC
GACGTGTCTACAT

Last Updated on 23.10.2014 13:25