Sequences from confirmation amplicon


Confirmation sequences for line 858D04 and hit At1g63570 are shown.
Line ID 858D04
Locus At1g63570 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:23575271
Primers used for PCR MA75 - 8474, show primer details
   
Sequence Name 85-K102437-0022-858-D04C-8409
GenBank Accession LN514530 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>85-K102437-0022-858-D04C-8409
GCCATTTACAATTGAATATATCCTGATAACATAATAACATAATTATCATATATGAGAAAA
AAATACACTAGTTTTACATATTCTTCCTCTGAATTGGTATTACCATATCCTTATTTAGAC
ACTATTTTGAAAAAATCAACAAAGAAAAGCTCTTTTCATTCCACTATAAATTCTCTATCT
CCTCTGTTTCGTCGAACAATACAGAACAAAATGGCAAGAATCATACTCACTGCTCCTCTG
TTTTACTTCTTCTTTTCCTTGTTATCTCACCAAACCATGTCCCAACCTCAACACATGCAC
ACTTTCTGCAGCGTCGACAGCTTCACACAAACCAGCTCCTACGAAACAAACCGCAACATC
CTACTCACCACTCTCAGCTTGACTTCCTCGCTCGTACACTATTTAAACGCCACAATCGGT
CTCAGCCCCGACACAGTCTATGGCATGTTCCTCTGTAGAGGAGACATCAACACAACATCT
TGCTCAGACTGTGTTCAAACCGCAGCAATCGAGATCGCTACAAACTGTACTCTTAACAAA
AGAGCTTTCATATACTACGACGAGTGTATGGTTCGATACTCAAATGTTTCCTTCTTCTCT
GAATTTGAAAGTAAACCAGTCATCGTTCGTTACTCTCTTCGTTCTGCTCCAAACTCAAAC
CGGTTTAACCAAACCCTATCCAATAAATTAGACCAACTGATTCCTAACGTCTCTCCGTCA
ACTTT
   
Sequence Name 85-K102438-0022-858-D04C-MA75
GenBank Accession LN514531 [GenBank]
Sequencing primer gene specific primer, MA75: 5'-AAAATACGGTATCAAAGTTGACGG-3'
Sequence (A. th genome BLAST matches underlined)
>85-K102438-0022-858-D04C-MA75
ATTATTGGAAGGGTTTGGTTAACCGGTTTGAGTTTGGAGCAGAACGAAGAGAGTAACGAA
CGATGACTGGTTTACTTTCAAATTCAGAGAAGAAGGAAACATTTGAGTATCGAACCATAC
ACTCGTCGTAGTATATGAAAGCTCTTTTGTTAAGAGTACAGTTTGTAGCGATCTCGATTG
CTGCGGTTTGAACACAGTCTGAGCAAGATGTTGTGTTGATGTCTCCTCTACAGAGGAACA
TGCCATAGACTGTGTCGGGGCTGAGACCGATTGTGGCGTTTAAATAGTGTACGAGCGAGG
AAGTCAAGCTGAGAGTGGTGAGTAGGATGTTGCGGTTTGTTTCGTAGGAGCTGGTTTGTG
TGAAGCTGTCGACGCTGCAGAAAGTGTGCATGTGTTGAGGTTGGGACATGGTTTGGTGAG
ATAACAAGGAAAAGAAGAAGTAAAACAGAGGAGCAGTGAGTATGATTCTTGCCATTTTGT
TCTGTATTGTTCGACGAAACAGAGGAGATAGAGAATTTATAGTGGAATGAAAAGAGCTTT
TCTTTGTTGATTTTTTCAAAATAGTGTCTAAATAAGGATATGGTAATACCAATTCAGAGG
AAGAATATGTAAAACTAGTGTATTTTTTTCTCATATATGATAATTATGTTATTATGTTAT
CAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGA
GTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAA
ATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTA
CGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTA
TTTCGACGTGTCTACAT

Last Updated on 23.10.2014 13:25