Sequences from confirmation amplicon


Confirmation sequences for line 879C05 and hit At2g25360 are shown.
Line ID 879C05
Locus At2g25360 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:10805799
Primers used for PCR NR77 - 8474, show primer details
   
Sequence Name 71-K102596-0022-879-C05C-8409
GenBank Accession LN512536 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>71-K102596-0022-879-C05C-8409
CATTTACAATTGAATATATCCTGAAATTAAAGAGAATAATAATCCCTGAAAAAGTTCTCA
TCAAAGCCTCCAGAAAACAGTTAAACCGCCATAATTGTTGTAGTCGTCCCAATTGTCATC
ATTTCCATCAGCATTCTCTTCTTCACTGAAAAACTGCTCAGTATTCCACATCCTGATCAT
CTCTCGGCGCGTCATAGCTTCAAGAACCATATAACAAAGTCAAATACAACAATACAGTGC
AAGTTTAAGAAACAAAGGAGTAAATAAGAAAGTTAACATCATTTTTGGATTTGCCATTTG
CTGATCAATATATTCTTCATAGCTAGGCCAACGACGACCTTCTTCATCAGAATAGTAATT
ACATGTATCTACTTCAAAATCATATTCCGGTTCATTATAATCATAATCATCATAATAACC
ATGTCCCGTTAGTAGGCAACCAGAAGAGCAAGTCTTTTGGTCATTCTTCCATTCAACCTC
ACATTGGTAACAAAACTGATATCCACATCTACACAATGAATGCACAAAGTTTAACATTAC
GAAATGAAAGTACTCGAATGATGTAGAATAATCGAGTTAAATAAATATATACCTGCAAGT
CATGTGGTTGCAGGCATGAGAAAGTTCGATCATGTGCCTACACATTTTACACTGACGCCA
TTTTTTGTCCTTTGCTAGAGACTTTAGCTTCAACTCATCAACTAGAGGGTCATGGTGAAG
TTTTTTGTACTCAGCACACGACAAATCAGAATGTGATGGTACTTTGCAATCAATGCAGAA
GAGTCCACAACATTTGACACAAGAACGGTCATTGGATAGGTCGGATTCACTAGAAAGCTC
GGTTTTGGACATTAGCATTGAGCAGTTTG
   
Sequence Name 71-K102597-0022-879-C05C-NR77
GenBank Accession LN512537 [GenBank]
Sequencing primer gene specific primer, NR77: 5'-GAGAATCTATTGCCCATATCCAAA-3'
Sequence (A. th genome BLAST matches underlined)
>71-K102597-0022-879-C05C-NR77
GGACTGTGAATCGACCTATCCATGACCGTTCTTGTGTCAATGTTGTGGACTCTTCTGCAT
TGATTGCAAAGTACCATCACATTCTGATTTGTCGTGTGCTGAGTACAAAAAACTTCACCA
TGACCCTCTAGTTGATGAGTTGAAGCTAAAGTCTCTAGCAAAGGACAAAAAATGGCGTCA
GTGTAAAATGTGTAGGCACATGATCGAACTTTCTCATGCCTGCAACCACATGACTTGCAG
GTATATATTTATTTAACTCGATTATTCTACATCATTCGAGTACTTTCATTTCGTAATGTT
AAACTTTGTGCATTCATTGTGTAGATGTGGATATCAGTTTTGTTACCAATGTGAGGTTGA
ATGGAAGAATGACCAAAAGACTTGCTCTTCTGGTTGCCTACTAACGGGACATGGTTATTA
TGATGATTATGATTATAATGAACCGGAATATGATTTTGAAGTAGATACATGTAATTACTA
TTCTGATGAAGAAGGTCGTCGTTGGCCTAGCTATGAAGAATATATTGATCAGCAAATGGC
AAATCCAAAAATGATGTTAACTTTCTTATTTACTCCTTTGTTTCTTAAACTTGCACTGTA
TTGTTGTATTTGACTTTGTTATATGGTTCTTGAAGCTATGACGCGCCGAGAGATGATCAG
GATGTGGAATACTGAGCAGTTTTTCAGTGAAGAAGAGAATGCTGATGGAAATGATGACAA
TTGGGACGACTACAACAATTATGGCGGTTTAACTGTTTTCTGGAGGCTTTGATGAGAACT
TTTTCAGGGATTATTATTCTCTTTAATTTCAGGATATATTCAATTGTAAATGGCTTCATG
TCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGA
GTAATTACCAATTTTTTTTCATTCAAAAATGTAGATGT

Last Updated on 23.10.2014 13:25