SimpleSearch - Line and FST details


Line specific information

 
Line ID 408C09
Vector Used pAC161
Line Availability available as T3 set from NASC (N439105)
Segregation Analysis 50:33:23
Confirmed for Hit At5g01390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g01390

 
Sequence (A. th genome BLAST matches underlined)
>67-K017955-022-409-C09-8409
GTGNTATGTATTTCCCTTAAAAACCTTACCAAAATGCAACCAAAATAAATTAAAAAAACC
ATAAGCACATATGTCTGCTTCTAAAAGATTCCAAAAAAGCTATGGGATCCCTCCCTATAG
TGAGA
GenBank Accession BX288122 [GenBank]
Graphic View Graphic view of gene At5g01390
Predicted Position of Insertion Chr5:160355 - go to primer design
BLAST e Value 1e-31
Hit Clone Code (BAC ID) T10O8
Hit Gene Code At5g01390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNAJ heat shock family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR809736 [GenBank]


Last Updated on 10.06.2021 13:37