SimpleSearch - Line and FST details


Line specific information

 
Line ID 447D01
Vector Used pAC161
Line Availability available as T3 set from NASC (N442853)
Segregation Analysis 50:37:26
Confirmed for Hit At3g46560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g46560

 
Sequence (A. th genome BLAST matches underlined)
>04-K024530-022-447-D01-8409
ATTGAATAATCCTGAAGAAGAAAAGCCNAAATGGCCTCCATGATCGATCAGCTTCAGCTC
CGTGATAGGTTCGTCACTTAAATCGGTTTCTCTGTTTTACATGTGAGAATTTCCCAAAAA
AATAGAACTGTAAACCAGTAT
GenBank Accession BX943307 [GenBank]
Graphic View Graphic view of gene At3g46560
Predicted Position of Insertion Chr3:17138667 - go to primer design
BLAST e Value 9e-35
Hit Clone Code (BAC ID) F12A12
Hit Gene Code At3g46560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tim10/DDP family zinc finger protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37