SimpleSearch - Line and FST details


Line specific information

 
Line ID 851F11
Vector Used pAC161
Line Availability available as T3 set from NASC (N481671)
Segregation Analysis 50:36:28
Confirmed for Hit At5g66870
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g66870

 
Sequence (A. th genome BLAST matches underlined) 
>86-K025842-022-851-F11-8409
AATTGAATATATCCTGATAGTTTAAACCGAAGGCGGGAAACGACAATCTGATCCCCGGGT
ATGGGATCCTCCCTATAGTGAGAACTTCTTTATTTTCAANAAAATTTATTAAAAAAAACT
GAATCTTTTTAATTCTTTATAATCTTTTCAAA
GenBank Accession CR402046 [GenBank]
Graphic View Graphic view of gene At5g66870
Predicted Position of Insertion Chr5:26706467 - go to primer design
BLAST e Value 6e-08
Hit Clone Code (BAC ID) MUD21
Hit Gene Code At5g66870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ASYMMETRIC LEAVES 2-like 1
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR402046 [GenBank]


Last Updated on 10.06.2021 13:37