SimpleSearch - Line and FST details


Line specific information

 
Line ID 942D02
Vector Used pAC161
Line Availability available as T3 set from NASC (N490374)
Segregation Analysis 50:44:1
Confirmed for Hit At3g59650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g59650

 
Sequence (A. th genome BLAST matches underlined)
>12-K032877-022-942-D02-8409
AAGAGTCGGAAAATAAACCAAGGTAATGATTTCCACTTTGTCCGTGGGAAATTTTGCAAA
TCACATAATGTGCAAAGACCTCCTTGCCTTCCTCAATACGTGTATGCAGATCCCCCCCAG
ATTGATCACAATGTTGCAAGTATCACGATTGGTCGTTTATCTGTATTGCAACCCCAAGTT
GTTTGTATGGGATCCTCCCTATAGTGAGACGTATTANTCACTTCCCTTTCATTTTCCCC
GenBank Accession CT955248 [GenBank]
Graphic View Graphic view of gene At3g59650
Predicted Position of Insertion Chr3:22033858 - go to primer design
BLAST e Value 3e-22
Hit Clone Code (BAC ID) T16L24
Hit Gene Code At3g59650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitochondrial ribosomal protein L51/S25/CI-B8 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37