DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_029945c
Line Availability available from NASC (N659352) and ABRC (SALK_029945c)
Confirmed for Hit At2g32010
Parent of DUPLO pair none
Parent of pair(s) 7978, 97619

Gene hit At2g32010

 
Sequence (A. th genome BLAST matches underlined)
CTCCTTAGCTCATCACCTTCTTTTTGTCCCGAGGTCAAATGGGTGCACACAAAGCAGAAG
CT
GenBank Accession ED578210 [GenBank]
Graphic View Graphic view of gene At2g32010
Predicted Position of Insertion Chr2:13627221 - go to primer design
BLAST e Value 4e-28
Hit Clone Code (BAC ID) F22D22
Hit Gene Code At2g32010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CVP2 like 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED578210 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37