DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_031879
Line Availability available from NASC (N531879) and ABRC (SALK_031879)
Confirmed for Hit At5g09600
Parent of DUPLO pair 12479
Parent of pair(s) none

Gene hit At5g09600

 
Sequence (A. th genome BLAST matches underlined)
ATGGAGTTCATCTGAGGCTGGTAAACAGAAAGGTGAGGAGATAAAGGGCGAAAGCT
GenBank Accession ED579277 [GenBank]
Graphic View Graphic view of gene At5g09600
Predicted Position of Insertion Chr5:2980307 - go to primer design
BLAST e Value 1e-24
Hit Clone Code (BAC ID) F17I14
Hit Gene Code At5g09600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation succinate dehydrogenase 3-1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37