DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_040054c
Line Availability available from NASC (N657193) and ABRC (SALK_040054c)
Confirmed for Hit At1g76970
Parent of DUPLO pair 603
Parent of pair(s) none

Gene hit At1g76970

 
Sequence (A. th genome BLAST matches underlined)
TTCGATGATGCAGGTCGGCAACCAAGCAAGTCCTATGATGAGATGAAGAATCTTCCACCT
CCGCCTTCAAGGCA
GenBank Accession BH746361 [GenBank]
Graphic View Graphic view of gene At1g76970
Predicted Position of Insertion Chr1:28923116 - go to primer design
BLAST e Value 6e-09
Hit Clone Code (BAC ID) F22K20
Hit Gene Code At1g76970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Target of Myb protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37