DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_073252c
Line Availability available from NASC (N662958) and ABRC (SALK_073252c)
Confirmed for Hit At3g04520
Parent of DUPLO pair 1001
Parent of pair(s) none

Gene hit At3g04520

 
Sequence (A. th genome BLAST matches underlined) 
GAATATGACCTCTCTTGCTTTGAAGTATGTAGTTTGCTTTCATCTACTGATATGTGCTTT
GATATTTTTAGTTTCTTTGCTACGCTTTATTCATTCATTGATTAA
GenBank Accession BH901142 [GenBank]
Graphic View Graphic view of gene At3g04520
Predicted Position of Insertion Chr3:1217539 - go to primer design
BLAST e Value 6e-44
Hit Clone Code (BAC ID) T27C4
Hit Gene Code At3g04520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation threonine aldolase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37