DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_125328c
Line Availability available from NASC (N658399) and ABRC (SALK_125328c)
Confirmed for Hit At1g04830
Parent of DUPLO pair 2276
Parent of pair(s) none

Gene hit At1g04830

 
Sequence (A. th genome BLAST matches underlined)
AATCGATAGATGCAGAAGTCACATTAGTTTACTGTTCCACTCATTTGCTTGATTAAAGAA
GACCCGGTCTGTATCGTATTGTTGCAGGAAAGCT
GenBank Accession BZ383239 [GenBank]
Graphic View Graphic view of gene At1g04830
Predicted Position of Insertion Chr1:1359338 - go to primer design
BLAST e Value 5e-47
Hit Clone Code (BAC ID) F13M7
Hit Gene Code At1g04830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ypt/Rab-GAP domain of gyp1p superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37