DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_137492c
Line Availability available from NASC (N680336) and ABRC (SALK_137492c)
Confirmed for Hit At1g20200
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g20200

 
Sequence (A. th genome BLAST matches underlined)
GCATCAGCTCGTCCTTAAATCTGATCCATCATCGTCACTTTCTCCCGGCGA
GenBank Accession BZ766501 [GenBank]
Graphic View Graphic view of gene At1g20200
Predicted Position of Insertion Chr1:7004380 - go to primer design
BLAST e Value 1e-21
Hit Clone Code (BAC ID) T20H2
Hit Gene Code At1g20200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PAM domain (PCI/PINT associated module) protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37