SimpleSearch - Line and FST details


Line specific information

 
Line ID 001C07
Vector Used pAC106
Line Availability only available from NASC (N400031)
Segregation Analysis 50:7:7
Confirmed for Hit At5g18610
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F6B6

 
Sequence (A. th genome BLAST matches underlined)
>51-K026783-022-001-C07-8409
NNTTTTGGCGGTATCCGGAATGAAGCCTTTACATTGAATATATCCTAGCTCCTTCTTTTG
GAGCACTTAGCTCCTTCCTCGGTTCAGGACCTCGTCGAGACTTTGATTTATCTACCGAAA
TAAAATAAAATGTTAGTATGGGATCCTCCCTATACTGAGCCGTATTACGAGCGACGGTGC
AACGGAGTGATCCACATGGGACTTTTAAACATCCTCCGTCGGATGGCGTTGCGAGAGAAG
CAGTCGATCCGTGAGATCAACCGACGCACCGGGCAGGCGCGCAACACGATCGCAAAGTAT
TTGAACGCAGGTATGGGATCCTCCCTATAGTGAGACATATTGAACATGTTGTTCATTCGG
TTTCATAAGGAGATAATCTTGTCTCCAAAAGACAAATGAAGAGATCACAATTTATAGAAA
ACGAATAACGAGTTACACCGGAAAATAGTTTATCAATCACGATCACATCCGTTTCAAACA
AATAAATCCACCAATTCTTTAAAAATTCATAAAGGCATGAATGCTTGA
GenBank Accession CR394623 [GenBank]
Graphic View Graphic view of sequence CR394623 of line 001C07
Predicted Position of Insertion Chr5:17651935 - go to primer design
BLAST e Value 2e-72
Hit Clone Code (BAC ID) F6B6
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g23890

 
Sequence (A. th genome BLAST matches underlined)
>51-K025787-022-001-C07-8409
CCCTATAGCGGAGCGGCGTATACGGATCATCAGCTCAATCTAAAGATTATGTGCAGTATG
GGATCCTCCCTATAGTGAGCCGNTCCAAAGTTACATTTAAATTACAAGAATAATAAAAAA
TAATCATACGAACGCAGGGGAGCATGAGATCCTCCCTATCCTGCAACCTAGTACCTCCAA
GTTAACACAAGTCCTCCTATACATCCTACACAACAACGAGATTCTAGTGTCGTCTTCCAG
ACCCTAGCTTCTTTTTGCCCGAGCGGGCTATTCACTCAAACGTTCACTTTATCCGTCCCG
CGAGATTTACCGCCTCGCATCCCTACCTCCAAACGGTTACTACGCTAGCCAAATCCTCCG
TCATCACATTCCATTGAAGCAAATCTA
GenBank Accession CR394622 [GenBank]
Graphic View Graphic view of gene At5g23890
Predicted Position of Insertion Chr5:8059446 - go to primer design
BLAST e Value 1e-09
Hit Clone Code (BAC ID) MRO11
Hit Gene Code At5g23890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At5g18610

 
Sequence (A. th genome BLAST matches underlined)
>51-K026818-022-001-C07-8409
AGCCATTTACATTGAATAATCATACTCCTTCTTTTGGAGCAGTTAGCTCCTTCTTCTGTT
CAGGACCTCGTCGAGACTTTGATTTATCTACCGAAATAAAATAAAATGTTAGTATGGGAT
CCTCCCTATAGTGAGTCGTATTACTCGCGGCGTTGGGGGGTCTCGTTTAAGGGGGGGGTT
GTGGACCTCTGCGGTTGGGTGGTGGGGGGAGAGAAGTTTTCTTTCCTTGTTTTTTTTCGA
GGTGTTGGGGATGTGCGTATCTTTTCGTTTTGTATGTGAACGCAGGTATGGGATCCTCCC
TATGTTGAGTCGTG
GenBank Accession CR394624 [GenBank]
Graphic View Graphic view of gene At5g18610
Predicted Position of Insertion Chr5:6193499 - go to primer design
BLAST e Value 1e-42
Hit Clone Code (BAC ID) T28N17
Hit Gene Code At5g18610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03