SimpleSearch - Line and FST details


Line specific information

 
Line ID 001H07
Vector Used pAC106
Line Availability only available from NASC (N400091)
Segregation Analysis 113:18:14
Confirmed for Hit At4g18960
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g18960

Sequence (A. th genome BLAST matches underlined)
>14-011374-strizhov-1H7-oriL
GGGCATACTCATTGCTGATCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAAT
ATATTCATATTATCATTAGTGGGAATATTTGTTTGATATGTTTATTTTATTTACTTCGGG
GGTTTTTGTAACAATTTTGTAGATCTAATTTCTTGTTCTTCATGTGTATATTAATTTTCC
CTTAAGACTTAAATAAAAAGAGAGAATTTGTTATATATAGATATATGAAGTGAGGGAAAT
GGTATGGGATCCTCCCTATAGTGAGTCGTATTACTCANNNNNNNNNCTGNTNNCTGGGAA
GGCAGATTTATAGCCCTTAAGATGATCAGGCCCTAATGCCCCGGGGCCAAAAGCCACGCT
TTGCTCTTGATGGTCAACTCGAAAAAGGTTTGAATAACTTATGTTGGAAGGCTTTGTCTA
CAGACTTGTTCTCGTTACTAAAGATCCATTTCGCGAAACAGAATTATGGGATCCTTCCTA
TAGGGAGGCGTATTACTCAAGGCNNAANNGGGGGGGGNANNCNCCCNCCCACCNCCCCCC
CCCCCCCCCCCCCCCNNCCCCACCCCCCCGCCCCCCCCAAACACGGGCGCCATTCCGGCG
CCAATGACNTATATTTGCATATCGCGCGAAACCCATCTCCCCCGCCAAAGACGACCCATA
CTACAAAACAAAACAG
GenBank Accession AL751365 [GenBank]
Graphic View Graphic view of gene At4g18960
Predicted Position of Insertion Chr4:10384371 - go to primer design
BLAST e Value 6e-92
Hit Clone Code (BAC ID) F13C5
Hit Gene Code At4g18960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation K-box region and MADS-box transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Rosso et al. 2003, ag-GK01]


Last Updated on 07.07.2016 14:03