SimpleSearch - Line and FST details


Line specific information

 
Line ID 002E04
Vector Used pAC106
Line Availability only available from NASC (N400148)
Segregation Analysis 50:4:4
Confirmed for Hit At4g14690
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g72710

 
Sequence (A. th genome BLAST matches underlined)
>29-K027008-022-002-E04-8409
TTTATCTCTCTTATTATTCTTTTCTTTTTTTAGTTTTCTCCATGGAAAAATAATAATAAT
TGCGGAGTTGTTGGGCCGTATGGGATCCTCCCTATAGTGAGACTGTTTGCTCACCCCTCT
GTGGGTGGTGCCACTCTGGGCGTACGGGACCCTCCCTATCTTGAGGCCTATTGGTAATTA
CTCTTTCTTTATCTCCGTATTGAGCATCTTACTCGTTGCTGATCCATGAAGATTTCCCGG
AGATGATGCCCTTTATGTGTCGCAATAGGCGGTCGCGCTTGGAGAGCCGCCAGGGAGAAG
GACTGGCCGGGAGGGCCCAGGGAAGGAAAGAGAGGAGAAG
GenBank Accession FR799796 [GenBank]
Graphic View Graphic view of gene At1g72710
Predicted Position of Insertion Chr1:27372233 - go to primer design
BLAST e Value 1e-18
Hit Clone Code (BAC ID) F28P22
Hit Gene Code At1g72710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation casein kinase 1-like protein 2
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At4g14690

 
Sequence (A. th genome BLAST matches underlined)
>29-K026784-022-002-E04-8409
CGGACAGTAAGCCATTTACAATTGAATATATCCTGTGCACCCGTTGGAGATCCTCCCGGG
ACGGACACTGGTAGGTGCCCGAGTCGTTGATCAGCATGGAGTTCTCAAAGGGAGAAAACG
TGTTTGCTCAGATCTCTGACGGTGGTGTCGGGTGGTTTCAAGGAACACAGCGTTGTTGAC
GTTGGCATCGATGGGTCCGTTGNTCANNGGAGGGGGGGGGGGGGGGGATCTNAANNNTTC
CTCACTTCCAACNCCNANCTATGNANCTNTCNNTTTGCNATACTCCANCTCCTTNCNTTA
CACTACACCTACTNTAACATCCTACCTTNANCAANCCAATATCCACCCATAAATTTATAN
AAAAACTAAATACAATCCCAAACCATACCTGCCCCCCCGATCGAGTCTGGCGGCAGATCT
TCAGTACATGCGGGGGGGGGGGGGGGGGAACTGGCTAAGATGACGAAACTGAGGAGAGCG
AACGAGGAGATAGGGTGGTGATACAGGCGAAGGAGAG
GenBank Accession CR394758 [GenBank]
Graphic View Graphic view of gene At4g14690
Predicted Position of Insertion Chr4:8418819 - go to primer design
BLAST e Value 1e-43
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chlorophyll A-B binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03