SimpleSearch - Line and FST details


Line specific information

 
Line ID 003B09
Vector Used pAC106
Line Availability only available from NASC (N400213)
Segregation Analysis 60:47:35
Confirmed for Hit At5g17040
Parent of DUPLO pair none
Parent of pair(s) 7137, 9767, 9783

Gene hit At5g17040

 
Sequence (A. th genome BLAST matches underlined)
>66-K025792-022-003-B09-8409
GTTTGTGAATCCTTTCAATGAGAGAGTACTTTGGATATATAAACAAATAATCTTGGCCAT
GTTTTGCAATGACCATGAACACACCTTTTTTGTATCAACATAGTGTATGTGAGACTCTTT
ATCCTTTGTTTATATCTTTTACATTTTACAGCGTTCCAAATATTGGATCCACCATATACA
TATCCCAACAAATTGTATGTCGGTACATATATGTCTCGAGAAAAAAATATCTATCGTGTA
AACCACCCTCCATATAAAAAAATATCTATACGTCTGTCGATCTAAGGGCTTACTTTACAA
CATTGAATGAAAAACAGATGACACTTGATGAAAAAACTCCCCATATAATAAAAAAACCAC
AAATTCTACCTACCAAAACAATATACCAGGGACATACCCCAACGACTAATTAATGGTATA
CTTAACTTTGATTAACACATAAACCTCTATTCTTGCTCGGCGACTCATCTA
GenBank Accession CR394869 [GenBank]
Graphic View Graphic view of gene At5g17040
Predicted Position of Insertion Chr5:5605405 - go to primer design
BLAST e Value 2e-51
Hit Clone Code (BAC ID) F2K13
Hit Gene Code At5g17040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40