SimpleSearch - Line and FST details


Line specific information

 
Line ID 004H11
Vector Used pAC106
Line Availability only available from NASC (N400383)
Segregation Analysis 100:87:68
Confirmed for Hit At3g48590
Parent of DUPLO pair none
Parent of pair(s) 92413, 92414

Gene hit At3g48590

 
Sequence (A. th genome BLAST matches underlined)
>88-K014797-022-004-H11-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTCCCAAACAAAACCAAAACATTCA
AGTGAGTAAACCGCCGATGGGACAACCAGCTGGTCCTGGAGGGATGATGATTGGGAGACC
AGCTATGGATCCGAATGGTGTTTATGTCCAGCCTCCGTCTCAGGCGTGGCAGAGTGTTTG
GCAGACTTCGACGGGGACGGGAGATGATGTCTCTTATGGTAGTGGTGGAAGTTCCGGTCA
AGGGAATCTCGACGGCCAAGGGTAAAGTTTCATTTTCTGTGCAATGTGATATACATTGAT
TGATTACATGATCGCCTATGGGATCCT
GenBank Accession AL751543 [GenBank]
Graphic View Graphic view of gene At3g48590
Predicted Position of Insertion Chr3:18009440 - go to primer design
BLAST e Value 2e-135
Hit Clone Code (BAC ID) T8P19
Hit Gene Code At3g48590 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit C1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40