SimpleSearch - Line and FST details


Line specific information

 
Line ID 006B01
Vector Used pAC106
Line Availability only available from NASC (N400493)
Segregation Analysis 100:32:26
Confirmed for Hit MRO11
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At1g06180 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g06180

 
Sequence (A. th genome BLAST matches underlined)
>02-K014808-022-006-B01-8409
TTTGATCCATGTAGATTTCCCGGAATGAAGCATTACAATTGAAATATCCTGTAATAGCGT
TTATTAAAAGATCGAGTAATAAGTAACAAAACTATACATACTCCGGTGTTAGTTTTAACA
TGGAAGTAATCTATGGGATCCTCCTATAGTGACGAAATATACATATGGCAAATACCAAAT
ATAAAACGGCTTATAAACCGGCTATGGGATCCTCCCTATAGTGAGNCCTCTGCNNCACAT
AACNATGATGAAGAAAACTCGAGACGGGAAGGGAATGATGAAAAGGAATGATGAGCTGTG
CTATGGGATCCTCCATATAGCGAGAGATAACCCTTTGACTAGAGCAGCGGGTGCTGTACC
GAAACTGATTGCACAAGAGGGGAAATGGGGCACATTAAAATTACCTTCTGGACAGGACCC
CCCGATCTCCAAAACCCTGCTCGCCCCAGTCGCACAAGTGGGAAATGTTGGGCTAAACCA
GenBank Accession AL935858 [GenBank]
Graphic View Graphic view of gene At1g06180
Predicted Position of Insertion Chr1:1889782 - go to primer design
BLAST e Value 6e-09
Hit Clone Code (BAC ID) F9P14
Hit Gene Code At1g06180 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 13
Insertion Classification CDSi
Confirmation Status failed

Gene hit MRO11

 
Sequence (A. th genome BLAST matches underlined)
>66-K028181-022-006-B01t-8409
TCCTGTAATAGCGTTTATTAAAAGATCGAGTCAATAAGTTAACAAAACTATTACATACTC
CGGTGTTAGTTTTAACATGGAAGTAATCTAGAAATCTAAACCCGAAAAGTTTGTTTGCAA
GTTTAAAGGTTAGTAAAATTATCTCGATGGTTTATACTGTTAGTGAGATTTTTTCGAAGT
TTAAAGTGTTATCCAATAACAATTTAAAGGTTAAAAATGTTATTTTCCCCTAAATATACT
AATCGGTAAGATATCCATAGGTAATACCAAAACCAAGAAAGAAAGACCACTAATCTGTTT
ATACGGTGGAAATTAGTCCCACGCCTAAAAATCTTGTATGGGATCCTCCCTATAGTGAGT
CTTAAGAATGGGAGGATTNNAAGNAGGGGGGCGGCCTCACTATAGGGAGGATCCCA
GenBank Accession CR769804 [GenBank]
Graphic View Graphic view of sequence CR769804 of line 006B01
Predicted Position of Insertion Chr5:8092499 - go to primer design
BLAST e Value 4e-154
Hit Clone Code (BAC ID) MRO11
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR769805 [GenBank]


Last Updated on 14.10.2014 10:23