SimpleSearch - Line and FST details


Line specific information

 
Line ID 006C10
Vector Used pAC106
Line Availability only available from NASC (N400514)
Segregation Analysis 100:100:84
Confirmed for Hit At1g02970
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g08610

 
Sequence (A. th genome BLAST matches underlined)
>75-K014798-022-006-C10-8409
TGATCCATGTAGATTTCCCGGACTGAAGCACTTTACAATTGAATATGTTGTTCATGGCTC
AAAAATGTACATGGCCGTTATTCTAATAATGGACACTTCGATGACCGATAATTTGCACTA
TGGGATCCTGCCTGTAGAGAGGGTCCATGAATATTTCAATACTACAGGACGCTTTACCTA
TGGGATTCTCCCTTTAGTGAGATGATGTATTCTTGATTTGCAGGATGCCATCAACTAACA
GGAGACGCTGTACCTATGGGATGCTGCGTAGAATAAGAAATGAATATCTGGAAAGATGGC
TCATCCTATGGGATCCTCCCTTAAGTGA
GenBank Accession AL751664 [GenBank]
Graphic View Graphic view of gene At3g08610
Predicted Position of Insertion Chr3:2615678 - go to primer design
BLAST e Value 2e-08
Hit Clone Code (BAC ID) F17O14
Hit Gene Code At3g08610 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At1g02970

 
Sequence (A. th genome BLAST matches underlined)
>75-K014808-022-006-C10-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATGATGTATATGG
CTCTAAAAATGTAAATGTCCATTATTACTAAAATGGCACAATTGAAGACCTGATATTTGT
AGCTATGGGATCCTCCCTATAGTGAGATCCCACCCAAAGTAATAATATTCATCGTCATGT
TCGAGAAGAACGGAAGAACACTGTTGGCGAAGAGGAAAACCCAAGGGACAATCAAAACCA
GGGCATCGAAGAAGATTCGGAAGATGGAAGGGACATTGGAGCGTCACTCTCTGCTTCAAT
TCGGTCAATTGTCGAAGATTTCTTTCGAAAATCGTCCGTCGTCGAATGTTGCTTCATCGG
CGTTTCAGGGTCTCCTGGATTCGGATTCTTCGGAACTCCGAAATCAGTTGGGTTCCGCTG
ATTCAGATGCCAATTGCGGAGAGAAGGACTTTATTCTTAGCCAAGACTTCTTCTGGTAAA
TCTTCGTTAACTCTGGCATTTCTTAGCTGTGTATATCTAATTCGAGATCTATCGTTATCT
TCTATGGGATCC
GenBank Accession BX890642 [GenBank]
Graphic View Graphic view of gene At1g02970
Predicted Position of Insertion Chr1:673290 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F22D16
Hit Gene Code At1g02970 [TAIR] [MIPS] [SIGnAL]
Gene Annotation WEE1 kinase homolog
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG967694 [GenBank]


Last Updated on 14.10.2014 10:23