SimpleSearch - Line and FST details


Line specific information

 
Line ID 007D11
Vector Used pAC106
Line Availability only available from NASC (N400623)
Segregation Analysis 50:47:35
Confirmed for Hit At5g02560
Parent of DUPLO pair none
Parent of pair(s) 5974, 6046

Gene hit At5g02560

 
Sequence (A. th genome BLAST matches underlined)
>84-K014809-022-007-D11-8409
NTGATCCATGTAGCATTTCCCGGACATGGAAGCCTTTACTTAGCGCTAATATATCTCTAT
CTAAGATTTTGAGATTTGCAAAGCAAAGATGTTAAACCTAATTGAAAGTGAAACCATGTC
TTGAGGTTGATCTACTCGTGATATAGTATCTAACAAATTCAATTTTACAACCTCAGATGA
TTATCAATTTACCCTAAAATCAGAAGAAGACATTCTACACCTATAGATGGTCAACGAAGC
AACAGAACAAAACCCACAAGAATTCTATGGGATCC
GenBank Accession AL751768 [GenBank]
Graphic View Graphic view of gene At5g02560
Predicted Position of Insertion Chr5:575941 - go to primer design
BLAST e Value 2e-123
Hit Clone Code (BAC ID) T22P11
Hit Gene Code At5g02560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone H2A 12
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL751767 [GenBank]


Last Updated on 31.08.2016 09:40