SimpleSearch - Line and FST details


Line specific information

 
Line ID 008F10
Vector Used pAC106
Line Availability only available from NASC (N400742)
Segregation Analysis 87:87:82
Confirmed for Hit At1g14280
Parent of DUPLO pair 148
Parent of pair(s) none

Gene hit At1g14280

 
Sequence (A. th genome BLAST matches underlined)
>78-K014800-022-008-F10-8409
TTGATCCATGTAGATTTCCCCGACCATGAGCCTTTTACANTTGAGTATTCCTCCAGCTCT
TGGAGCTTCGGTCCCCAAAGATTCTCTCATTTGGAACTTCTGGATCTGGCAGAGGAGACA
CAAGCCTATGGGATCCTCCCTTTAGTGAG
GenBank Accession AL751899 [GenBank]
Graphic View Graphic view of gene At1g14280
Predicted Position of Insertion Chr1:4878007 - go to primer design
BLAST e Value 3e-14
Hit Clone Code (BAC ID) F14L17
Hit Gene Code At1g14280 [TAIR] [MIPS] [SIGnAL]
Gene Annotation phytochrome kinase substrate 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g03930

 
Sequence (A. th genome BLAST matches underlined)
>78-K014810-022-008-F10-8409
TTGATCCATGTATNGATTTCCGGAAATGAANGCATTTACAATTGAATATATATCTCAACT
ATGGATGATTTCGGTACACAATATAGATATCTTTCCTCTTGGAAGCGATAGGATCTGGCA
GAGGAGACACAAGTCTATGGGATCCTCATATTANNGAGTNNCANNTTATGAGAATTAATG
CAAAAAAACATAAAAATAATTGAGAGTCATTGTGGTGAGATATAAAGAAGATTTGTAACA
CTAAAAATATGGATGGTGAATAACATAAAACTTCATTCCAAAACAAAGAAAAGAGAAGTC
ACAGGTGATGATGGCCAAAGAAGGAGAACATTCCGGAGCTAAGGAAGTGAAACTTACCAA
ACCCAAAATTTCCTTGTCGGATCTCACCTTTGTCATTTACGTAACTACCCCAAAAAAGCT
ATCATTCTTCACCATAAGTTGGTGAGGAGATACCACTTAACAAATG
GenBank Accession AL751900 [GenBank]
Graphic View Graphic view of gene At5g03930
Predicted Position of Insertion Chr5:1059259 - go to primer design
BLAST e Value 5e-130
Hit Clone Code (BAC ID) F8F6
Hit Gene Code At5g03930 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 14.10.2014 10:23