SimpleSearch - Line and FST details


Line specific information

 
Line ID 008G02
Vector Used pAC106
Line Availability only available from NASC (N400746)
Segregation Analysis 100:81:60
Confirmed for Hit At2g25820
Parent of DUPLO pair 11763
Parent of pair(s) none

Gene hit At2g25820

 
Sequence (A. th genome BLAST matches underlined)
>15-K014800-022-008-G02-8409
CTGATCCATGGTAGATTTCCCGGACATGAANGCATTTACCATGGGGGCATCGACACCAGC
CCCTCCAACGAGTCATACAGCGCACAATCGTATTTTACATTGTTTTCAAGACTCGGCAAC
TCCACAATATCTCCTATGGGATCCTCCCTTTAGTGAGATGAGGACGAGGACGAAGATGAG
GATGAGGATGAGGCTGAGGACGATGAGGATGACCACTTTTCGATCTTCTCAGTATCACAC
CTATGGGATCCTCCCTTAAGTGAG
GenBank Accession AL751905 [GenBank]
Graphic View Graphic view of gene At2g25820
Predicted Position of Insertion Chr2:11015571 - go to primer design
BLAST e Value 7e-49
Hit Clone Code (BAC ID) F17H15
Hit Gene Code At2g25820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR394938 [GenBank] CR394938 [GenBank]


Last Updated on 31.08.2016 09:40