SimpleSearch - Line and FST details


Line specific information

 
Line ID 009A02
Vector Used pAC106
Line Availability only available from NASC (N400770)
Segregation Analysis 100:95:85
Confirmed for Hit At1g60510 MPL12
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in T20E23 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g60510

 
Sequence (A. th genome BLAST matches underlined)
>09-K014859-022-009-A02-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCATTTACAATTGAATTATCAAGTGTTGA
GCCCAATGAACGAAAATTATCAAGTTACGCCTTTAGTCAAAATTCCAAACTTCACCACAA
AAGAATTCAGCGCATTGGAACCAATAAAATATTCAAATACACATCTTAAGAGAGACGTTT
TAGTTTCAACTACGAGCTATGGGATCCTATCATGTGGTGAGANGNATTTGNANNNNGNCA
AATGGATTTGTACCTACATAAATAGTGCAAGCCAGTGAGTTTTGGAAGCTATGAAACAAT
TCGTCGCTTTTGGGCTCAAAGTTATCGGAGAATGCCTGCTTCTA
GenBank Accession AL751940 [GenBank]
Graphic View Graphic view of gene At1g60510
Predicted Position of Insertion Chr1:22294336 - go to primer design
BLAST e Value 2e-77
Hit Clone Code (BAC ID) F8A5
Hit Gene Code At1g60510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences

Gene hit MPL12

 
Sequence (A. th genome BLAST matches underlined)
>01-K020160-022-009-A02t-8409
AGGTATCCTCTTTATTGTGAGGTTGTATTTGTAAAAAGTCAAATGTATTTGTACCTACGT
AAATAGTGCAAGCCAGTGAGTTTTGGAAGCTATAAAACAATTCGTCGCTTTTGGTCTCAA
AGTTATCGGAGAATGTCTACTTCTATGGGATCCTCCCTATAGTGAGANNNNNNNNNNG
GenBank Accession BX530726 [GenBank]
Graphic View Graphic view of sequence BX530726 of line 009A02
Predicted Position of Insertion Chr5:18779518 - go to primer design
BLAST e Value 3e-64
Hit Clone Code (BAC ID) MPL12
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR769809 [GenBank] CR769808 [GenBank] FR799960 [GenBank] FR799961 [GenBank] FR799961 [GenBank]

Gene hit T20E23

 
Sequence (A. th genome BLAST matches underlined)
>57-K014860-022-009-A02-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGGATGT
AATCTACGACCAAATCGATTCTCAAATCTTCTTTCAATAGTTTATATAAAGGGTAAAAGT
ATTTTTTGGCGGGCATAATTATCGCTTTTTGCCATTTTTACCCCCGTACCATTACAGACA
AAATAATAAAGAGCTCTGGGGCCAGTATGATAAATTGGTATAGGGACCTACCATACACTT
TCTCCCTTTTTCTTTTTGATAGCGATTGCGCCAATATAAAAAGGGTATTTCCAGTGGTGG
TTCTGTCAATTAGACAACAACAACAACAGCAACAACATGCCTCAGCTCCTGCAAACTTCA
CCTCATTTGGAATGGTTCCTATGGGATCCT
GenBank Accession AL751941 [GenBank]
Graphic View Graphic view of sequence AL751941 of line 009A02
Predicted Position of Insertion Chr3:18750322 - go to primer design
BLAST e Value 3e-35
Hit Clone Code (BAC ID) T20E23
Insertion Classification Genome Hit
Confirmation Status failed


Last Updated on 31.08.2016 09:40