SimpleSearch - Line and FST details


Line specific information

 
Line ID 009B03
Vector Used pAC106
Line Availability only available from NASC (N400783)
Segregation Analysis 60:57:42
Confirmed for Hit At1g43650
Parent of DUPLO pair 2657
Parent of pair(s) none

Gene hit At4g35790

 
Sequence (A. th genome BLAST matches underlined)
>79-K120751-0022-009-B03C-8474
TTTGCCATATCTGAGGCTCACCATTTGATTTACATGTGGGGTTGGTCTATCTTCCATAAG
ATTAAGCTGTTAGGGAAACAAAAGTTCCCAGAGATAAGGATATGACGCTCGGGGAATTGC
TCAAATACAAATCCCAGGAAGGTGTTCGAGTTTTGCTACTCGTATGGGATGATAAGACTT
CTCATGATAAGTTTGGGATAAAAACGGTTAGTGTTTTCACAAGTTCTTAGGATTCGTAAT
GCTATTTTTGAGCTTTTGGATTACTAGTGGTAATGTTAATCGGAGTTTCTGGTGAGGATA
AGATATGTTTCGACAGGTCATCCGGTGTGTTCGACATTTAGATGGAGTGTGACATTTAT
GenBank Accession LT615049 [GenBank]
Graphic View Graphic view of gene At4g35790
Predicted Position of Insertion Chr4:16959134 - go to primer design
BLAST e Value 5e-146
Hit Clone Code (BAC ID) F4B14
Hit Gene Code At4g35790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phospholipase D delta
Insertion Classification CDSi
Confirmation Status failed

Gene hit At1g43650

 
Sequence (A. th genome BLAST matches underlined)
>18-K014859-022-009-B03-8409
TTGATCCATGTAGATTATCCCGGGCATGAACGCCTTTACATTTGAAAACATACGATATAA
TACATACTGTTGTGGTATATGTGGGATACTTTTAGTTAGGTAGACAAAGTATAGAATATC
AAATTCTTAAGATGTTTTTCAACGGACCCATATAAACTTCGATTATATTTCGATTAAAAA
AACGTTTTCATAGAAATATTACATTTTTGGAAAGATCACTAAATCTATATATGAAGAAAG
CAAGGCTCCGATGTTACGTAGTTGGACCTCCACCATGGTATGAAAAACGGCTATGGGATC
CTCCCTATAAATGA
GenBank Accession AL751947 [GenBank]
Graphic View Graphic view of gene At1g43650
Predicted Position of Insertion Chr1:16445106 - go to primer design
BLAST e Value 9e-101
Hit Clone Code (BAC ID) T10P12
Hit Gene Code At1g43650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nodulin MtN21 /EamA-like transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40