SimpleSearch - Line and FST details


Line specific information

 
Line ID 009G02
Vector Used pAC106
Line Availability only available from NASC (N400842)
Segregation Analysis 50:11:10
Confirmed for Hit At2g27820
Parent of DUPLO pair none
Parent of pair(s) 4347, 4349, 4430, 4453, 8440
Note Although the line exists, the insertion in At1g08520 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g27820

 
Sequence (A. th genome BLAST matches underlined)
>15-K027912-022-009-G02-8409
CGACATCGCCTATTGTCATCACTCACGTGCACTTTCTCGTGAGCATACACTATACTCGTC
TTAAACGGCCGATCAGTTCTCGGTATAATCGGTTCACGCGCCAACATCACAAAGCGCGTG
ACGTTACTCGCGTCATCTTGTATCCCATCTTCCAAAATCTCCAATCCGTAGATCTCCGCC
GCGCGTGCACTCGCAATCGCGGCGGTGTCACGGATATTATTCGCAGCGATAAACTCCGCC
GCACCGGCGGTATCATCAACAGCTTCACGAGCTACGTTGAGACCGAGTTTAGTCAACGTG
TGTTCGCATTGAGCTAGTCCTTGAGGATGANAGATCGCACGAGTGAGAAACTCTTTCGGT
ATGGAAACCTCCCTATAGAGATAGTCAAGAGAAGAAACACTAACGCGCGAACTATTGACC
TTCAAGAATGTCCAACTCCGCAGCGAACATATATAACAATAGTTCT
GenBank Accession CR769851 [GenBank]
Graphic View Graphic view of gene At2g27820
Predicted Position of Insertion Chr2:11857864 - go to primer design
BLAST e Value 5e-178
Hit Clone Code (BAC ID) F15K20
Hit Gene Code At2g27820 [TAIR] [MIPS] [SIGnAL]
Gene Annotation prephenate dehydratase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL751975 [GenBank]

Gene hit At2g46020

 
Sequence (A. th genome BLAST matches underlined)
>63-K014860-022-009-G02-8409
CTGATCCATGTAGATTTCCCCGACATGAAGCTCATTTACAATTTATCATTGAAAAAAATT
GGTAATTACTCTTTCTTTTACTCTCTGCTTTTGCGTTTAGGAACATTAGTTTGACTAAGA
TTGAGCCTATGGGATCCTCCTATTAGTGAGATCGGAATCCGGCCATGGGCCCGGCTGGTC
GGACTGCTTCCACGTCATCCGCTGCTTCTCCTTCTNCTTCCTCTTCATCTGTGCAGCAGC
AGCAACAGCAACAGCAACAGCAGCAACAGCAACAGCAGCTGGCGCCTATGGGATCCTCCC
TTNAGTGA
GenBank Accession AL751976 [GenBank]
Graphic View Graphic view of gene At2g46020
Predicted Position of Insertion Chr2:18923336 - go to primer design
BLAST e Value 6e-34
Hit Clone Code (BAC ID) F4I18
Hit Gene Code At2g46020 [TAIR] [MIPS] [SIGnAL]
Gene Annotation transcription regulatory protein SNF2, putative
Insertion Classification CDSi
Confirmation Status failed

Gene hit At1g08520

 
Sequence (A. th genome BLAST matches underlined)
>15-K028723-022-009-G02-8409
CAATACTATCTCTTAACTTCTTCTTCTTCTTCTTCTTCTTCTCCTATCTTTGAAAATGGC
GATGACTCCGGTCGCGTCATCATCTCCAGTTTCAGCCTGCAGACTCTTTCGCTGCAATCT
CCTCCCTGATCTCTTACCTAAGCCTCTGTTTCTCTCCCTCCCCAAACGAAACAGAATTGC
CTCGTGCCGCTTCACTGTATGGGATCCTCCCTATAGTGAGNCNTANTNNNNNNNNNNNN
GenBank Accession CR933991 [GenBank]
Graphic View Graphic view of gene At1g08520
Predicted Position of Insertion Chr1:2696423 - go to primer design
BLAST e Value 3e-81
Hit Clone Code (BAC ID) T27G7
Hit Gene Code At1g08520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ALBINA 1
Insertion Classification TS2TE (5')
Confirmation Status failed, line belongs to a contamination group, please check line 009D11 or 885D07


Last Updated on 14.10.2014 10:23