SimpleSearch - Line and FST details


Line specific information

 
Line ID 009H04
Vector Used pAC106
Line Availability only available from NASC (N400856)
Segregation Analysis 60:60:46
Confirmed for Hit At4g13240
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g13240

 
Sequence (A. th genome BLAST matches underlined)
>19-K105032-0022-009-H04C-35St
CAGCATCGAAATATTCGCTTTTTTCGTCCATTAGACTATCTATTGTGATGGTGGATTTAT
CACAAATGGGACCCGCCGCCGACAGAGGTGTGATGTTAGGCCAGGACTTTGAAAATTTGC
GCAACTATCGTATAGTGGCCGACAAATTGACGCCGAGTTGACAGACTGCCTAGCATTTGA
GTGAATTATGTAAGGTAATGGGCTACACTGAATTGGTAGCTCAAACTGTCAGTATTTATG
TATATGAGTGTATATTTTCGCATAATCTCAGACCAATCTGAAGATGAAATGGGTATCTGG
GAATGGCGAAATCAAGGCATCGATCGTGAAGTTTCTCATCTAAGCCCCCATTTGGACGTG
AATGTAGACACGTCGAAATAAAGATTTCCGAATTAGAATAATTTGTTTATTGCTTTCGCC
TATAAATACGACGGATCGTAATTTGTCGTTTTATCAAAATGTACTTTCATTTTATAATAA
CGCTGCGGACATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTTCTTTTTCT
CCATATTGACCATCATACTCATTGCTGATCCATGTAGATTTCCCGGACATGAAGCCATTT
ACAATTGAATATATCCTGATGGATCTTCGAACTACTCAGGAGAGGAAATAGAGAAGCTTG
AATCACAAAACTCATCAAAGACGACATTGCTTGATTTTATTGGTTGGAGTGACAATAGTT
CAAAAGGGCAGTCAGAGAAACCTCCAAAATCTCCGAGAATGACGCCAAAGAAACTCTCAT
ATTTGGAGAAGCTTGAGAACTTAAATGGTTTTAGGAGCCCTAAAGATAGGCATTGAAGAT
GAATCAAAAGACATGTGAACAACTAAAATGATACAATTGAAGAAGCCATATAAGTGTGTA
TATTTAGGCAAAAGAATAAACAATTAGCAATAACATATCT
GenBank Accession HG968557 [GenBank]
Graphic View Graphic view of gene At4g13240
Predicted Position of Insertion Chr4:7682198 - go to primer design
BLAST e Value 1e-173
Hit Clone Code (BAC ID) F17N18
Hit Gene Code At4g13240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RHO guanyl-nucleotide exchange factor 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR799989 [GenBank] CR934000 [GenBank] CR769859 [GenBank]

Gene hit At4g03298

 
Sequence (A. th genome BLAST matches underlined)
>76-K016930w-022-009-H04T-8409
CTGTAATTATAGTAGTATCATGAAAACCAAGCCGGTTTAAATAATACCGATTACGAAAAG
GCAAATCAATTAGACGTGGGGATAGTTTTGACACTGGGCTTTCGTATTGTCAAATTTGAA
GATGGGCTTTTGTACAAAGCCCAAATACTACAACATTCGGTTACATTAAACCGACAACAA
CGGAAAGGAAAGTCAATGAACGAGGGTAGATACGACATTTCAGAGACGGTGTTTTAGGGC
TATGGGATCTCCCTTATAGTGAGANCNAAANAANGNTATATCNNAAATTTATATATGATT
CATGACGGCCAATATTTTCTTAATCTTTCCTAGATGCTCCTCCTGACAAGAGAGAGCATC
AGCACCTGTACCGAAAGCATCTAGAGCTCAGCATGACTCCGCTGTACATCGTAATGTAAT
TCCGAGTTTGAGGCGATCCAAGGTGAGATGAAGATAGTTCGCGATCGTCTACTAATGTGA
CTATCCGAGTCTAGAGATAGTTTCTACCTGCGTGACGAGGTCCAAATTGATGCTAATAAA
AAGCTATAGCTCTAATCTAA
GenBank Accession AL935927 [GenBank]
Graphic View Graphic view of gene At4g03298
Predicted Position of Insertion Chr4:1446625 - go to primer design
BLAST e Value 3e-125
Hit Clone Code (BAC ID) F4C21
Hit Gene Code At4g03298 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 07.07.2016 14:03