SimpleSearch - Line and FST details


Line specific information

 
Line ID 010G07
Vector Used pAC106
Line Availability only available from NASC (N400943)
Segregation Analysis 50:43:33
Confirmed for Hit At3g05940
Parent of DUPLO pair 2392
Parent of pair(s) none

Gene hit At3g05940

 
Sequence (A. th genome BLAST matches underlined)
>55-K014861-022-010-G07-8409
AATTTTGATCCATGTAGCATTTCCTTGGACATGAAGCATTTACAATTGAATATATACGTG
TTGCATCCCACCACTACCATTAGACGGGTTAGTTTGCAGAATAAACCTACATTCTCTGTG
CTTATATTAGTGCATTTGCATATATCTTTGATTTCTCCTATGATTTTTTTCACAAAATCT
TGGAACTTCTTAAATTCTTAACCAAACCATGCCAAGGATCTTTATGAATGATCATTTGGT
TGCATGCACTCTGGGTTAGCAGAAGCATTAGATTATTTTAGTCCAGATATATCTGTGGGA
GTCTTGTTTTCGAGTTCTATGACGACTGCCTTAATTAACATGTAGTAACTTATACAAGAT
TATCTTTTCATATAGGCGTTTTATTATACGATGCAAGCAAGGTTGTCTGCAATTTGTTAT
TCTAAAGCCAATCCTATGGGATCCTCCATTNAGNTGAGGAAAANNNNANNNGGGGGGGCC
GAGTTTTGTTTTCAATAAAACATGGCGATGGGAAGAGCGTTATGAGAGGGGCNCCGNNCN
NTGGGGGGGGAAGAAAAGAGGAAAGAGAAGAAACGAGAAG
GenBank Accession AL752060 [GenBank]
Graphic View Graphic view of gene At3g05940
Predicted Position of Insertion Chr3:1778997 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F10A16
Hit Gene Code At3g05940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function (DUF300)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03