SimpleSearch - Line and FST details


Line specific information

 
Line ID 010G07
Vector Used pAC106
Line Availability available as T3 set from NASC (N400943)
Segregation Analysis 50:43:33
Confirmed for Hit At3g05940
Parent of DUPLO pair 2392
Parent of pair(s) none

Gene hit At3g05940

 
Sequence (A. th genome BLAST matches underlined) 
>75-K035341-022-010-G07C-8409
ACAAAGCCTTAACCATGAGGTCTGCTTTTGTTGAAACTAAAGTTTAAAATTATGTTCGTC
ATCTATTCCCAAGAGTCAATGAGAACTTAGTATAGTAACTCGAGTAAGTAC
GenBank Accession HG968559 [GenBank]
Graphic View Graphic view of gene At3g05940
Predicted Position of Insertion Chr3:1779143 - go to primer design
BLAST e Value 7e-50
Hit Clone Code (BAC ID) F10A16
Hit Gene Code At3g05940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation organic solute transporter ostalpha protein (DUF300)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG968559 [GenBank]


Last Updated on 10.06.2021 13:37