SimpleSearch - Line and FST details


Line specific information

 
Line ID 011E08
Vector Used pAC106
Line Availability only available from NASC (N401016)
Segregation Analysis 100:92:68
Confirmed for Hit At5g66710
Parent of DUPLO pair none
Parent of pair(s) 2242, 2692, 97316
Note Although the line exists, the insertion in At2g46510 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g46510

 
Sequence (A. th genome BLAST matches underlined)
>61-K012256-022-011-E08-8409
ATGAAGCACTAACACTTGAATATATCCTGAATATTTTATTTGATTTTCTAAAGTATAGGA
AATATTTTCCCAAGATACAAATATGTGAATCAATGGTCTAAATAAAGTTAATGAATATAC
TTAAACCGGATTCCTTTCACTATAAGAAAGAGAAAAGAAAAAAGGATTTTATCTATTTCT
ATGGGATCCTCCCTATAGTGAGTCGANTTACTC
GenBank Accession CT025960 [GenBank]
Graphic View Graphic view of gene At2g46510
Predicted Position of Insertion Chr2:19090970 - go to primer design
BLAST e Value 2e-77
Hit Clone Code (BAC ID) F11C10
Hit Gene Code At2g46510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABA-inducible BHLH-type transcription factor
Insertion Classification TS2TE (3')
Confirmation Status failed, line belongs to a contamination group, please check line 013E08
Other FSTs Supporting this Hit CT025961 [GenBank]

Gene hit At5g66710

 
Sequence (A. th genome BLAST matches underlined)
>11-K028095-022-011-E08C-8409
ATTTGGGCGTGAATGTAGACACGTCGAAATAAAGATTTCCGAATTAGAATAATTTGTTTA
TTGCTTTCGCCTATAAATACGACGGATCGTAATTTGTCGTTTTATCAGTATGCCACAATA
CAAAGATTACTCATTCAAACACCCACATCAGAATCTTCCTTCTTATTGTAATTCATGGTT
TCTCTGTAACATTAATCCTTTTTTGAGGCATTGTGTAGGAAACACTAGAGCTGAGACTAC
ATAAACCTAAGAGTGACAAAACCTAACACTAACCAGCATGAAAGATTCCAAATTTCAAGG
TTAAACCCAAAATTAAATCACCAATATACCCTGAAACCTATACTCTTCGAATAAATACCG
AAATCAAGAAAGGATAAACAGGAAAACAAAATCTGCAATTTTTGCACCAAACCCAGAAGC
AATTTCGAAGTAGGAGATTGAGAAACGAGAAACCCACAATCCTCTGTAGACAGTAGATGA
TGAACCTTCGCCGATGAAGTCCCCTATAGATA
GenBank Accession HG968560 [GenBank]
Graphic View Graphic view of gene At5g66710
Predicted Position of Insertion Chr5:26637225 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MSN2
Hit Gene Code At5g66710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03