SimpleSearch - Line and FST details


Line specific information

 
Line ID 011F07
Vector Used pAC106
Line Availability only available from NASC (N401027)
Segregation Analysis 50:44:30
Confirmed for Hit At1g23310 At1g23310
Parent of DUPLO pair 2490
Parent of pair(s) none

Gene hit At3g41762

 
Sequence (A. th genome BLAST matches underlined)
>54-K012433-022-011-F07-8409
TGAAGCCGTTACAAACAGGGTCGGAGCTTTTTCAGCATTTCTCGGAAAAAATTGCTGAGT
GGCCGAGAAGAATGGGCGTGTCATGCGTGGGCTGACATGGATTCTTCGAGGCCTATGGGA
TCCTCCCTATAGTGAGTCTATTTACTCAACAGAGACCGCCGTACTCGATGCGGATCACTG
AAGACAATACCCGAGACCACCCACGTCCGTGTCATAGTCATTAGTGCTCCAATACCGTTC
TTGCACAAGCATCAAAAGCGAAGCAAATAATCTCTAGAAGAGAATAACCTAGTGGTGGAG
ATTCCACACGAACAGATTGGTAGGTTAGCCCTGTGGTGGACCTGGCTATCTGCAGAAATA
TATGCGCATGGAACATGACCAATAGGGTCGATCCACGTGTCCGTGCGCTTTTGTTTCGTC
CTCTTTTAGACCCAGCAGCCAGCAGCTGTTGTGTATACTATGGGATCCTGCCTATAGTGA
GTCGAATTAC
GenBank Accession AL752260 [GenBank]
Graphic View Graphic view of gene At3g41762
Predicted Position of Insertion Chr3:14196141 - go to primer design
BLAST e Value 3e-38
Hit Clone Code (BAC ID) F21A14
Hit Gene Code At3g41762 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At1g23310

 
Sequence (A. th genome BLAST matches underlined)
>54-K013044-022-011-F07-35St
TGACGTAAGGGATGACGCACAATCCACTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTTACTACTGTTTTTCCCGCCTTCGGTTTAATCCACTACTACAGTTA
AATCCTTCAAAAATAAAAAAAGAAGGGTAAAGAATCTGCTACTACTGTTTCTTTCTTGCT
CATCTGATCTCTTCTTATGAACTCATTCCACTTGTGGATTTTGACAGTGTGTTCCATCTG
AGGACAACAATCCTGCCAGCAGAAGATGAGATGCCGGAGATCATGGATAGCTTCAAGAAG
TTCAACGACGAGTTCATGACTCAGTATGATAATAACTTTGGTTATTCGAAAATGTGATTA
CTTCTTCTTCTGAACGACTATTGTGTTCTGCTACACTCTTTAAAGCTAAATCTCTGTAGT
ACACTCTTTCTCTTTGCCCTATTCTATAAACCATATCTCTCTCTTTGTGTCTCTTTTTTT
TGGGTGTAAACTCTCTCTTGNGTCTCTATTTCTATTTTCAATTGGGAAACTGATTAAGAT
CTTTTTCTCACTGAAATGAAATTTAGGCCCTAGAATATTTTTTTTTAATCAACGGGGGAT
AGCCTTTTTTTTAGTGTGGCAATGAGGAAATTTGTAATTATGCTAA
GenBank Accession AL752261 [GenBank]
Graphic View Graphic view of gene At1g23310
Predicted Position of Insertion Chr1:8268981 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F26F24
Hit Gene Code At1g23310 [TAIR] [MIPS] [SIGnAL]
Gene Annotation glutamate:glyoxylate aminotransferase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g23310

 
Sequence (A. th genome BLAST matches underlined)
>72-K016930w-022-011-F07T-8409
TTTCCCGGACTGAAGCCTTTACTGTAGAGTTAAAATATTAGTGTGTGTGATTTTAAAAGT
ATTTTGTGTAGCAGATTACAAATGTGTGTATGACATGAGTTTGGATCATTCCTCAATCTA
ATCTATGTGGCTTCACAACAAAGGAAGCAGCAGAGCCACTGAAATTGACGAAGAGGATTT
GTCAGACAAAAGTCAATTCACGATATCTCTATATCCGTGTCTCGTTTTTATGCTACGAAG
ACCGTTCTTGCTTAATTATAAAAATAGAAGCAGATAATTTTTGAAGAGAATAAAAATGTG
GTGGAGATTCCAGACGAAGAGATTGTTAGTTTTGTCATGTTATGGACTGTTTTTCTGAGT
AAATTATGCGTTTGGAACATGACCAATAGGGTCGATCCACGTGTCCGGCGTTTTTGTTTC
GTCCTCTTTAAGACGCAGCAGCCAGCAGCTTTGTGTTTGCTATGGGACCTTCCCNAAAAG
TTGAGGAAACACACACGACGTGTCGTGCTCTCTGCATGAGACGAAGATTTTCATGCTTGC
CAGTAAGATCCTACAAAGAATCTGTTATGTACTGTTCCGCCAGCCTATAAGTGAGACATC
CCGCTACGTCCCTCTACTTGAAATACTTTGACTCCATGAGAATTCGCACCTAAATGCACG
GAGGACACTCTGTGTGATCGNNCCNNTTATTTGCGGGGCCGGTTGAAAAACGGGAAGGAT
CCAAAAAAAACCAATCTTTCCTTTAGTTGGTGAGACCCCCCCTTTAATTGTACCATGGGG
GGATAAAGAAATTTCCAAATCCCCCTAACTATGGGATCGAAAGGATCTATGAATTGACCC
GAAGATCCGT
GenBank Accession AL935987 [GenBank]
Graphic View Graphic view of gene At1g23310
Predicted Position of Insertion Chr1:8271726 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F26F24
Hit Gene Code At1g23310 [TAIR] [MIPS] [SIGnAL]
Gene Annotation glutamate:glyoxylate aminotransferase
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23